Rat Cldn5 ORF/cDNA clone-Adenovirus plasmid (NM_031701.2)

Pre-made Rat Cldn5/ adenoviral expression plasmid for Cldn5 adenovirus packaging, Cldn5 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to CLDN5/Cldn5/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000568 Rat Cldn5 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000568
Gene Name Cldn5
Accession Number NM_031701.2
Gene ID 65131
Species Rat
Product Type Adenovirus plasmid (overexpression)
Insert Length 657 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGTCTGCAGCGTTGGAAATTCTGGGTCTGGTGCTGTGTCTGGTAGGCTGGGTGGGCTTGATCCTGGCGTGTGGGCTGCCCATGTGGCAGGTGACTGCCTTCCTGGACCACAATATCGTGACGGCGCAGACGACTTGGAAGGGGCTGTGGATGTCGTGCGTGGTGCAGAGCACCGGGCACATGCAATGCAAAGTGTATGAGTCTGTGCTGGCGCTGAGCGCGGAGGTGCAGGCAGCTCGGGCACTCACCGTGGGCGCTGTGCTGCTGGCGCTTGTGGCACTCTTTGTTACCTTGACCGGCGCTCAGTGCACCACCTGCGTGGCCCCGGGCCCAGTTAAGGCACGGGTGGCACTCACGGGAGGAGCGCTTTATGCCCTGTGTGGGCTTCTGGCACTGGTGCCACTCTGCTGGTTCGCCAACATCGTAGTCCGGGAGTTCTATGATCCAACGGTGCCGGTGTCTCAGAAGTACGAGCTGGGCGCGGCGCTGTACATCGGCTGGGCGGCCTCCGCACTGCTCATGTGTGGCGGCGGCCTCGTGTGCTGTGGCGCCTGGGTTTGCACCGGGCGTCCAGAGTTCAGTTTTCCAGTCAAGTACTCAGCACCAAGGCGAACCACGGCCAACGGCGATTACGACAAGAAGAACTACGTCTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-MP0285-Ab Anti-CLD5/ CLDN5/ AWAL monoclonal antibody
    Target Antigen GM-Tg-g-MP0285-Ag CLDN5 VLP (virus-like particle)
    ORF Viral Vector pGMAP000568 Rat Cldn5 Adenovirus plasmid
    ORF Viral Vector vGMAP000568 Rat Cldn5 Adenovirus particle


    Target information

    Target ID GM-MP0285
    Target Name CLDN5
    Gene ID 7122, 12741, 711884, 65131, 101081005, 100684266, 617453, 102149057
    Gene Symbol and Synonyms AWAL,BEC1,CLDN5,CPETRL1,MBEC1,TMDVCF,TMVCF
    Uniprot Accession O00501
    Uniprot Entry Name CLD5_HUMAN
    Protein Sub-location Transmembrane Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000184113
    Target Classification Not Available

    This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets. Mutations in this gene have been found in patients with velocardiofacial syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2018]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.