Rat Cldn5 ORF/cDNA clone-Adenovirus plasmid (NM_031701.2)
Pre-made Rat Cldn5/ adenoviral expression plasmid for Cldn5 adenovirus packaging, Cldn5 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to CLDN5/Cldn5/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000568 | Rat Cldn5 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000568 |
Gene Name | Cldn5 |
Accession Number | NM_031701.2 |
Gene ID | 65131 |
Species | Rat |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 657 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGGGTCTGCAGCGTTGGAAATTCTGGGTCTGGTGCTGTGTCTGGTAGGCTGGGTGGGCTTGATCCTGGCGTGTGGGCTGCCCATGTGGCAGGTGACTGCCTTCCTGGACCACAATATCGTGACGGCGCAGACGACTTGGAAGGGGCTGTGGATGTCGTGCGTGGTGCAGAGCACCGGGCACATGCAATGCAAAGTGTATGAGTCTGTGCTGGCGCTGAGCGCGGAGGTGCAGGCAGCTCGGGCACTCACCGTGGGCGCTGTGCTGCTGGCGCTTGTGGCACTCTTTGTTACCTTGACCGGCGCTCAGTGCACCACCTGCGTGGCCCCGGGCCCAGTTAAGGCACGGGTGGCACTCACGGGAGGAGCGCTTTATGCCCTGTGTGGGCTTCTGGCACTGGTGCCACTCTGCTGGTTCGCCAACATCGTAGTCCGGGAGTTCTATGATCCAACGGTGCCGGTGTCTCAGAAGTACGAGCTGGGCGCGGCGCTGTACATCGGCTGGGCGGCCTCCGCACTGCTCATGTGTGGCGGCGGCCTCGTGTGCTGTGGCGCCTGGGTTTGCACCGGGCGTCCAGAGTTCAGTTTTCCAGTCAAGTACTCAGCACCAAGGCGAACCACGGCCAACGGCGATTACGACAAGAAGAACTACGTCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-MP0285-Ab | Anti-CLD5/ CLDN5/ AWAL monoclonal antibody |
Target Antigen | GM-Tg-g-MP0285-Ag | CLDN5 VLP (virus-like particle) |
ORF Viral Vector | pGMAP000568 | Rat Cldn5 Adenovirus plasmid |
ORF Viral Vector | vGMAP000568 | Rat Cldn5 Adenovirus particle |
Target information
Target ID | GM-MP0285 |
Target Name | CLDN5 |
Gene ID | 7122, 12741, 711884, 65131, 101081005, 100684266, 617453, 102149057 |
Gene Symbol and Synonyms | AWAL,BEC1,CLDN5,CPETRL1,MBEC1,TMDVCF,TMVCF |
Uniprot Accession | O00501 |
Uniprot Entry Name | CLD5_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000184113 |
Target Classification | Not Available |
This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets. Mutations in this gene have been found in patients with velocardiofacial syndrome. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, May 2018]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.