Human CDKN2A/ARF/ CDK4I ORF/cDNA clone-Lentivirus plasmid (NM_001195132.1)

Pre-made Human CDKN2A/ARF/ CDK4I Lentiviral expression plasmid for CDKN2A lentivirus packaging, CDKN2A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to CDKN2A/ARF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV000916 Human CDKN2A Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV000916
Gene Name CDKN2A
Accession Number NM_001195132.1
Gene ID 1029
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 504 bp
Gene Alias ARF, CDK4I, CDKN2, CMM2, INK4, INK4A, MLM, MTS-1, MTS1, P14, P14ARF, P16, P16-INK4A, P16INK4, P16INK4A, P19, P19ARF, TP16
Fluorescent Reporter
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGCCGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCGGCCCGGGGTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGGCGCTGCCCAACGCACCGAATAGTTACGGTCGGAGGCCGATCCAGGTCATGATGATGGGCAGCGCCCGAGTGGCGGAGCTGCTGCTGCTCCACGGCGCGGAGCCCAACTGCGCCGACCCCGCCACTCTCACCCGACCCGTGCACGACGCTGCCCGGGAGGGCTTCCTGGACACGCTGGTGGTGCTGCACCGGGCCGGGGCGCGGCTGGACGTGCGCGATGCCTGGGGCCGTCTGCCCGTGGACCTGGCTGAGGAGCTGGGCCATCGCGATGTCGCACGGTACCTGCGCGCGGCTGCGGGGGGCACCAGAGGCAGTAACCATGCCCGCATAGATGCCGCGGAAGGTCCCTCAGAAATGATCGGAAACCATTTGTGGGTTTGTAGAAGCAGGCATGCGTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T16452-Ab Anti-CDKN2A monoclonal antibody
    Target Antigen GM-Tg-g-T16452-Ag CDKN2A protein
    ORF Viral Vector pGMLV000916 Human CDKN2A Lentivirus plasmid
    ORF Viral Vector pGMLV001697 Human CDKN2A Lentivirus plasmid
    ORF Viral Vector pGMAD000002 Human CDKN2A Adenovirus plasmid
    ORF Viral Vector vGMLV000916 Human CDKN2A Lentivirus particle
    ORF Viral Vector vGMLV001697 Human CDKN2A Lentivirus particle
    ORF Viral Vector vGMAD000002 Human CDKN2A Adenovirus particle


    Target information

    Target ID GM-T16452
    Target Name CDKN2A
    Gene ID 1029
    Gene Symbol and Synonyms ARF,CDK4I,CDKN2,CDKN2A,CMM2,INK4,INK4A,MLM,MTS-1,MTS1,P14,P14ARF,P16,P16-INK4A,P16INK4,P16INK4A,P19,P19ARF,TP16
    Uniprot Accession P42771, Q8N726
    Uniprot Entry Name CDN2A_HUMAN,ARF_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Prostate Cancer, Skin cancer - melanoma
    Gene Ensembl ENSG00000147889
    Target Classification Not Available

    This gene generates several transcript variants which differ in their first exons. At least three alternatively spliced variants encoding distinct proteins have been reported, two of which encode structurally related isoforms known to function as inhibitors of CDK4 kinase. The remaining transcript includes an alternate first exon located 20 Kb upstream of the remainder of the gene; this transcript contains an alternate open reading frame (ARF) that specifies a protein which is structurally unrelated to the products of the other variants. This ARF product functions as a stabilizer of the tumor suppressor protein p53 as it can interact with, and sequester, the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53. In spite of the structural and functional differences, the CDK inhibitor isoforms and the ARF product encoded by this gene, through the regulatory roles of CDK4 and p53 in cell cycle G1 progression, share a common functionality in cell cycle G1 control. This gene is frequently mutated or deleted in a wide variety of tumors, and is known to be an important tumor suppressor gene. [provided by RefSeq, Sep 2012]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.