Rat Gpx4/gpx-4/ Gshpx-4 ORF/cDNA clone-Lentivirus plasmid (NM_001039849.3)

Pre-made Rat Gpx4/gpx-4/ Gshpx-4 Lentiviral expression plasmid for Gpx4 lentivirus packaging, Gpx4 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to GPX4/Gpx4/gpx-4 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV000936 Rat Gpx4 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV000936
Gene Name Gpx4
Accession Number NM_001039849.3
Gene ID 29328
Species Rat
Product Type Lentivirus plasmid (overexpression)
Insert Length 762 bp
Gene Alias gpx-4, Gshpx-4, Phgpx, snGpx
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGGGCCGCGCGGCCGCCCGCAAGCGGGGACGCTGCAGACAGCGCGGCCGGTCCCCGGGAGGCCGGCGACGGCGTGAACCTGGACGCCAAAGTCCTAGGAAGCGCCCAGGCCCTCGGAGGAGGAGAGCTCGCGCGCGCCGCCGCAGGAGGGCGCGCCCTCGCCGGATGGAGCCCATTCCCGAGCCTTTCAACCCGCGGCCTCTGCTGCAGGACCTTCCCCAGACCAGCAACAGCCACGAGTTCCTGGGCTTGTGTGCATCCCGCGATGATTGGCGCTGTGCGCGCTCCATGCACGAATTCGCAGCCAAGGACATCGATGGGCACATGGTTTGCCTGGATAAGTACAGGGGTTGCGTGTGCATCGTCACCAACGTGGCCTCGCAATGAGGCAAAACCGACGTAAACTACACTCAGCTAGTCGATCTGCATGCCCGATACGCCGAGTGTGGTTTACGAATCCTGGCCTTCCCTTGCAACCAGTTCGGGAGGCAGGAGCCAGGAAGTAATCAAGAAATCAAGGAGTTTGCAGCCGGCTACAATGTCAGGTTTGACATGTACAGCAAGATCTGTGTAAATGGGGACGATGCCCACCCACTGTGGAAATGGATGAAAGTCCAGCCCAAGGGCAGGGGCATGCTGGGAAATGCCATCAAATGGAACTTTACCAAGTTTCTCATTGATAAGAACGGCTGCGTGGTGAAGCGCTATGGTCCCATGGAGGAGCCCCAGGTGATAGAGAAGGACCTGCCGTGCTATCTCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1581-Ab Anti-GPX4/ GPx-4/ GSHPx-4 functional antibody
    Target Antigen GM-Tg-g-SE1581-Ag GPX4 protein
    ORF Viral Vector pGMLV000936 Rat Gpx4 Lentivirus plasmid
    ORF Viral Vector pGMLV001745 Human GPX4 Lentivirus plasmid
    ORF Viral Vector pGMPC000647 Human GPX4 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMLP003326 Human GPX4 Lentivirus plasmid
    ORF Viral Vector vGMLV000936 Rat Gpx4 Lentivirus particle
    ORF Viral Vector vGMLV001745 Human GPX4 Lentivirus particle
    ORF Viral Vector vGMLP003326 Human GPX4 Lentivirus particle


    Target information

    Target ID GM-SE1581
    Target Name GPX4
    Gene ID 2879, 625249, 705333, 29328, 101095956, 119864793, 286809, 102147383
    Gene Symbol and Synonyms GPx-4,GPX4,GSHPx-4,MCSP,mtPHGPx,PHGPx,SMDS,snGPx,snPHGPx
    Uniprot Accession P36969
    Uniprot Entry Name GPX4_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000167468
    Target Classification Not Available

    The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of hydrogen peroxide, organic hydroperoxides and lipid hydroperoxides, and thereby protect cells against oxidative damage. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme has a high preference for lipid hydroperoxides and protects cells against membrane lipid peroxidation and cell death. It is also required for normal sperm development; thus, it has been identified as a 'moonlighting' protein because of its ability to serve dual functions as a peroxidase, as well as a structural protein in mature spermatozoa. Mutations in this gene are associated with Sedaghatian type of spondylometaphyseal dysplasia (SMDS). This isozyme is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Transcript variants resulting from alternative splicing or use of alternate promoters have been described to encode isoforms with different subcellular localization. [provided by RefSeq, Dec 2018]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.