Rat Ngf/beta-NGF/ Ngfb ORF/cDNA clone-Lentivirus plasmid (NM_001277055.1)
Pre-made Rat Ngf/beta-NGF/ Ngfb Lentiviral expression plasmid for Ngf lentivirus packaging, Ngf lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to NGF/Ngf/beta-NGF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLV001031 | Rat Ngf Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLV001031 |
Gene Name | Ngf |
Accession Number | NM_001277055.1 |
Gene ID | 310738 |
Species | Rat |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 726 bp |
Gene Alias | beta-NGF, Ngfb |
Fluorescent Reporter | mCherry |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGTCCATGTTGTTCTACACTCTGATCACAGCGTTTTTGATCGGCGTACAGGCAGAACCGTACACAGATAGCAATGTCCCAGAGGGAGACTCTGTCCCTGAAGCCCACTGGACTAAACTTCAGCATTCCCTTGACACAGCCCTCCGCAGAGCCCGCAGTGCCCCTGCTGAACCAATAGCTGCCCGTGTGACAGGGCAGACCCGCAACATCACTGTGGACCCCAAACTGTTTAAGAAACGGAGACTCCGTTCACCCCGCGTGCTGTTTAGCACCCAGCCTCCACCCACCTCTTCGGACACTCTGGATTTAGACTTCCAGGCCCATGGTACAATCTCCTTCAACAGGACTCACAGGAGCAAGCGCTCATCCACCCACCCAGTCTTCCACATGGGGGAGTTTTCAGTGTGTGACAGTGTCAGTGTGTGGGTTGGAGATAAGACCACAGCCACGGACATCAAGGGCAAGGAGGTGACAGTGCTGGGCGAGGTGAACATTAACAACAGTGTATTCAAACAGTATTTTTTTGAGACCAAGTGCCGAGCCCCGAATCCTGTAGAGAGTGGATGCCGGGGCATTGACTCCAAGCACTGGAACTCATACTGCACCACGACTCACACCTTTGTCAAGGCGTTGACAACAGACGACAAACAGGCTGCCTGGAGGTTCATCAGGATAGATACAGCCTGCGTGTGTGTGCTCAGCAGGAAGGCTGCAAGAAGAGGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T85670-Ab | Anti-NGF/ Beta-NGF/ HSAN5B functional antibody |
Target Antigen | GM-Tg-g-T85670-Ag | NGF protein |
Cytokine | cks-Tg-g-GM-T85670 | Nerve growth factor (NGF) protein & antibody |
ORF Viral Vector | pGMLV000284 | Human NGF Lentivirus plasmid |
ORF Viral Vector | pGMLV001031 | Rat Ngf Lentivirus plasmid |
ORF Viral Vector | pGMAAV000148 | Rat Ngf Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV000485 | Human NGF Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMPC001164 | Human NGF Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000284 | Human NGF Lentivirus particle |
ORF Viral Vector | vGMLV001031 | Rat Ngf Lentivirus particle |
ORF Viral Vector | vGMAAV000148 | Rat Ngf Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV000485 | Human NGF Adeno-associate virus(AAV) particle |
Target information
Target ID | GM-T85670 |
Target Name | NGF |
Gene ID | 4803, 18049, 711681, 310738, 100144611, 403402, 281350, 100065669 |
Gene Symbol and Synonyms | Beta-NGF,HSAN5,NGF,NGFB |
Uniprot Accession | P01138 |
Uniprot Entry Name | NGF_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Cytokine Target |
Disease | Overactive bladder, Bladder Pain, Interstitial cystitis (chronic), Urinary Tract Infection, Neurological deficits - peripheral neuropathy, Parkinson's Disease |
Gene Ensembl | ENSG00000134259 |
Target Classification | Not Available |
This gene is a member of the NGF-beta family and encodes a secreted protein which homodimerizes and is incorporated into a larger complex. This protein has nerve growth stimulating activity and the complex is involved in the regulation of growth and the differentiation of sympathetic and certain sensory neurons. Mutations in this gene have been associated with hereditary sensory and autonomic neuropathy, type 5 (HSAN5), and dysregulation of this gene's expression is associated with allergic rhinitis. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.