Rat Txn1/Txn ORF/cDNA clone-Lentivirus plasmid (NM_053800.3)
Pre-made Rat Txn1/Txn Lentiviral expression plasmid for Txn1 lentivirus packaging, Txn1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to TXN/Txn1/Txn products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLV001614 | Rat Txn1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLV001614 |
Gene Name | Txn1 |
Accession Number | NM_053800.3 |
Gene ID | 116484 |
Species | Rat |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 318 bp |
Gene Alias | Txn |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGTGAAGCTGATCGAGAGCAAGGAAGCTTTTCAGGAGGCCCTGGCCGCTGCGGGAGACAAGCTTGTGGTAGTGGACTTCTCTGCCACGTGGTGTGGACCTTGCAAAATGATCAAGCCCTTCTTTCATTCCCTCTGTGACAAGTATTCCAATGTGGTGTTCCTTGAAGTAGACGTGGATGACTGCCAGGATGTTGCTGCAGACTGTGAAGTCAAATGCATGCCGACCTTCCAGTTCTATAAAAAGGGTCAAAAGGTTGGGGAGTTCTCTGGTGCTAACAAGGAAAAGCTCGAAGCCACTATTACGGAGTTTGCCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T85616-Ab | Anti-THIO/ TXN/ TRDX functional antibody |
Target Antigen | GM-Tg-g-T85616-Ag | TXN protein |
ORF Viral Vector | pGMLV001614 | Rat Txn1 Lentivirus plasmid |
ORF Viral Vector | pGMAD000153 | Human TXN Adenovirus plasmid |
ORF Viral Vector | pGMAD000538 | Rat Txn1 Adenovirus plasmid |
ORF Viral Vector | pGMAAV000880 | Rat Txn1 Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMAAV000969 | Human TXN Adeno-associate virus(AAV) plasmid |
ORF Viral Vector | pGMPC000200 | Human TXN Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP000876 | Human TXN Lentivirus plasmid |
ORF Viral Vector | vGMLV001614 | Rat Txn1 Lentivirus particle |
ORF Viral Vector | vGMAD000153 | Human TXN Adenovirus particle |
ORF Viral Vector | vGMAD000538 | Rat Txn1 Adenovirus particle |
ORF Viral Vector | vGMAAV000880 | Rat Txn1 Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMAAV000969 | Human TXN Adeno-associate virus(AAV) particle |
ORF Viral Vector | vGMLP000876 | Human TXN Lentivirus particle |
Target information
Target ID | GM-T85616 |
Target Name | TXN |
Gene ID | 7295, 22166, 712587, 116484, 101090655, 474798, 280950, 100033827 |
Gene Symbol and Synonyms | ADF,TRDX,TRX,TRX1,Trx80,TXN,TXN1 |
Uniprot Accession | P10599 |
Uniprot Entry Name | THIO_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000136810 |
Target Classification | Not Available |
The protein encoded by this gene acts as a homodimer and is involved in many redox reactions. The encoded protein is active in the reversible S-nitrosylation of cysteines in certain proteins, which is part of the response to intracellular nitric oxide. This protein is found in the cytoplasm. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.