Rat Hmox1/Heox/ HEOXG ORF/cDNA clone-Lentivirus plasmid (NM_012580.2)
Pre-made Rat Hmox1/Heox/ HEOXG Lentiviral expression plasmid for Hmox1 lentivirus packaging, Hmox1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to HMOX1/Hmox1/Heox products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLV001636 | Rat Hmox1 Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLV001636 |
Gene Name | Hmox1 |
Accession Number | NM_012580.2 |
Gene ID | 24451 |
Species | Rat |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 870 bp |
Gene Alias | Heox, HEOXG, Hmox, Ho-1, Ho1, hsp32 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGCGCCCACAGCTCGACAGCATGTCCCAGGATTTGTCCGAGGCCTTGAAGGAGGCCACCAAGGAGGTGCACATCCGTGCAGAGAATTCTGAGTTCATGAGGAACTTTCAGAAGGGTCAGGTGTCCAGGGAAGGCTTTAAGCTGGTGATGGCCTCCTTGTACCATATCTATACGGCCCTGGAAGAGGAGATAGAGCGAAACAAGCAGAACCCAGTCTATGCCCCACTCTACTTCCCTGAGGAGCTGCACCGAAGGGCTGCCCTAGAGCAGGACATGGCCTTCTGGTATGGGCCCCACTGGCAGGAGGCCATCCCTTACACACCAGCCACACAGCACTACGTAAAGCGTCTCCACGAGGTGGGAGGTACTCATCCTGAGCTGCTGGTGGCCCACGCATATACCCGCTACCTGGGTGACCTCTCAGGGGGTCAGGTCCTGAAGAAGATTGCGCAGAAGGCCATGGCCTTGCCAAGCTCTGGGGAAGGCCTGGCTTTTTTCACCTTCCCGAGCATCGACAACCCCACCAAGTTCAAACAGCTCTATCGTGCTCGCATGAACACTCTGGAGATGACCCCCGAGGTCAAGCACAGGGTGACAGAAGAGGCTAAGACCGCCTTCCTGCTCAACATTGAGCTGTTTGAGGAGCTGCAGGCACTGCTGACAGAGGAACACAAAGACCAGAGTCCCTCACAGACAGAGTTTCTTCGCCAGAGGCCTGCTAGCCTGGTTCAAGATACTACCTCTGCAGAGACGCCCCGAGGAAAATCCCAGATCAGCACTAGTTCATCCCAGACACCGCTCCTGCGATGGGTCCTCACACTCAGTTTCCTGTTGGCGACCGTGGCAGTGGGAATTTATGCCATGTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-IP0044 |
Target Name | HMOX1 |
Gene ID | 3162, 15368, 719266, 24451, 101092621, 442987, 513221, 100069058 |
Gene Symbol and Synonyms | bK286B10,D8Wsu38e,Hemox,Heox,HEOXG,Hmox,HMOX1,HMOX1D,HO-1,HO1,HSP32 |
Uniprot Accession | P09601 |
Uniprot Entry Name | HMOX1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Acute kidney failure, Renal tubulo-interstitial diseases |
Gene Ensembl | ENSG00000100292 |
Target Classification | Not Available |
Heme oxygenase, an essential enzyme in heme catabolism, cleaves heme to form biliverdin, which is subsequently converted to bilirubin by biliverdin reductase, and carbon monoxide, a putative neurotransmitter. Heme oxygenase activity is induced by its substrate heme and by various nonheme substances. Heme oxygenase occurs as 2 isozymes, an inducible heme oxygenase-1 and a constitutive heme oxygenase-2. HMOX1 and HMOX2 belong to the heme oxygenase family. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.