Rat Id1/ID125A/ Idb1 ORF/cDNA clone-Lentivirus plasmid (NM_012797.2)

Pre-made Rat Id1/ID125A/ Idb1 Lentiviral expression plasmid for Id1 lentivirus packaging, Id1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to ID1/Id1/ID125A products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV001708 Rat Id1 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV001708
Gene Name Id1
Accession Number NM_012797.2
Gene ID 25261
Species Rat
Product Type Lentivirus plasmid (overexpression)
Insert Length 447 bp
Gene Alias ID125A, Idb1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGGTCGCCAGTAGCAGTGCCGCGGCCACCGCAGGCCCCAGCTGTTCGCTGAAGGCAGGCAGGACGGCGGGCGAAGTGGTGCTTGGTCTGTCGGAGCAAAGCGTTGCCATCTCGCGCTGCGCTGGGACGCGCCTGCCCGCCTTGCTGGACGAACAGCAGGTGAACGTTCTGCTCTACGACATGAACGGCTGCTACTCACGCCTCAAGGAGCTGGTGCCTACCCTGCCTCAGAACCGCAAAGTGAGCAAGGTGGAGATACTGCAGCATGTTATCGACTACATCAGGGACCTGCAGCTGGAGCTGAACTCTGAGTCTGAAGTCGCGACCGCCGGAGGCCGGGGGCTGCCCGTCCGGGCCCCGCTCAGCACCCTGAACGGCGAGATCAGTGCCTTGGCGGCCGAGGCGGCATGTGTTCCAGCCGACGACCGCATCTTGTGTCGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1486-Ab Anti-ID1/ ID/ bHLHb24 functional antibody
    Target Antigen GM-Tg-g-SE1486-Ag ID1 protein
    ORF Viral Vector pGMLV000299 Human ID1 Lentivirus plasmid
    ORF Viral Vector pGMLV000839 Human ID1 Lentivirus plasmid
    ORF Viral Vector pGMLV001708 Rat Id1 Lentivirus plasmid
    ORF Viral Vector vGMLV000299 Human ID1 Lentivirus particle
    ORF Viral Vector vGMLV000839 Human ID1 Lentivirus particle
    ORF Viral Vector vGMLV001708 Rat Id1 Lentivirus particle


    Target information

    Target ID GM-SE1486
    Target Name ID1
    Gene ID 3397, 15901, 713160, 25261, 101097058, 609779, 497011, 100068419
    Gene Symbol and Synonyms bHLHb24,D2Wsu140e,ID,ID1,ID125A,Idb1
    Uniprot Accession P41134
    Uniprot Entry Name ID1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000125968
    Target Classification Not Available

    The protein encoded by this gene is a helix-loop-helix (HLH) protein that can form heterodimers with members of the basic HLH family of transcription factors. The encoded protein has no DNA binding activity and therefore can inhibit the DNA binding and transcriptional activation ability of basic HLH proteins with which it interacts. This protein may play a role in cell growth, senescence, and differentiation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.