Rat Rnls/RGD1309804 ORF/cDNA clone-Lentivirus plasmid (NM_001014167.2)

Pre-made Rat Rnls/RGD1309804 Lentiviral expression plasmid for Rnls lentivirus packaging, Rnls lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to RNLS/Rnls/RGD1309804 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV001925 Rat Rnls Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV001925
Gene Name Rnls
Accession Number NM_001014167.2
Gene ID 361751
Species Rat
Product Type Lentivirus plasmid (overexpression)
Insert Length 948 bp
Gene Alias RGD1309804
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGTTCCGGGTACTGGTGGTGGGCGCCGGGCTAACCGGAAGTTTGTGTGCCGCGCTGCTGAGGAAGGAGATAACCGCTCCCCTGTACCTCGCCCTGTGGGACAAGGCTGGGGACATAGGGGGAAGAATGACTACTGCCAACAGTCCTCATAATCCCCGATGCACGGCTGACTTGGGAGCTCAGTACATCACCTGTACTCCTCATTATGCCAAAAAGCACCAAAATTTTTATGAGGAGCTTTTAGCTCATGGGATTTTGGAGCCTCTGACGTCTCCCATTAAAGGAATGGAAGTGAAGGAAGGAGAAAGCAACTTTGTGGCACCTCACGGCGTTTCTTCCATTATCAAGTACTACTTGAAAGAATCAGGTGCTGAAGTCTTCCTCAGGCAGTGTGTGACTCAGATCAATCTAAGAGATAACAAGTGGGAAGTCTCTGAGGACACCGGCTCCACCCAGCAGTTTGACCTTGTCATCCTTACCATGCCAGCTCCTCAGATTCTGGGTCTTCAAGGTGACATTGTGAACTTAATTAGTGAACGCCAGAGGCAGCAACTGGCATCTGTGAGCTACTCCTCTCGCTATGCTCTGGGCCTCTTTTATGAAGCAGGCATGAAGATTGATGTCCCTTGGGCTGGCCAGTACATCACCAGTAATCCCTGCATACGCTTCATCTCCATTGACAGTAAGAAGCGCAACACAGAGTCATCAGAATGTGGCCCATTGCTGGTGGTCCATACCACCGTCCCATTTGGAGTCACACACTTGGAGCACAGTGAGGAGGATGTGCAGGAGTTAATCACCCAGCAACTGGAAACCATTCTGCCGGGCTTGCCGCCGCCAGTTGCTACCAAATGCTGGAAGTGGAGATATTCACAGGTTACAAACTCAGCTGCCAACAGTCCCGGCCAGATGACTCTTCATCTCAACCCTTTCCTGATATACATCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1252-Ab Anti-RNLS/ C10orf59/ RENALASE functional antibody
    Target Antigen GM-Tg-g-SE1252-Ag RNLS protein
    ORF Viral Vector pGMLV001925 Rat Rnls Lentivirus plasmid
    ORF Viral Vector pGMLP002259 Human RNLS Lentivirus plasmid
    ORF Viral Vector vGMLV001925 Rat Rnls Lentivirus particle
    ORF Viral Vector vGMLP002259 Human RNLS Lentivirus particle


    Target information

    Target ID GM-SE1252
    Target Name RNLS
    Gene ID 55328, 708585, 361751, 101098402, 610448, 534778, 100062318
    Gene Symbol and Synonyms C10orf59,RENALASE,RGD1309804,RNLS
    Uniprot Accession Q5VYX0
    Uniprot Entry Name RNLS_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000184719
    Target Classification Not Available

    Renalase is a flavin adenine dinucleotide-dependent amine oxidase that is secreted into the blood from the kidney (Xu et al., 2005 [PubMed 15841207]).[supplied by OMIM, Mar 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.