Rat Myc/c-myc/ mMyc ORF/cDNA clone-Lentivirus plasmid (NM_012603)
Pre-made Rat Myc/c-myc/ mMyc Lentiviral expression plasmid for Myc lentivirus packaging, Myc lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go
to MYC/Myc/c-myc products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMLV002028 | Rat Myc Lentivirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMLV002028 |
Gene Name | Myc |
Accession Number | NM_012603 |
Gene ID | 24577 |
Species | Rat |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 1362 bp |
Gene Alias | c-myc, mMyc, RNCMYC |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | CTGAATTTCCTTTGGGAGGTGGAAAACCCGACAGTCACGACGATGCCCCTCAACGTGAGCTTCGCTAACAGGAACTATGACCTCGACTACGACTCGGTGCAGCCCTATTTCATCTGCGACGAGGAAGAGAATTTCTATCACCAGCAACAGCAGAGCGAGCTGCAGCCGCCCGCACCCAGTGAGGATATCTGGAAGAAATTCGAGCTGCTGCCCACCCCGCCCCTGTCCCCCAGCCGCCGCTCCGGGCTCTGCTCTCCGTCCTATGTTGCGGTCGCTACGTCCTTCTCCCCAAGGGAGGACGATGACGGTGGCGGTGGCAACTTCTCCACCGCCGATCAGCTGGAGATGATGACCGAGCTACTTGGAGGAGACATGGTGAATCAGAGCTTCATCTGCGATCCTGACGATGAGACCTTCATCAAGAACATCATCATCCAGGACTGTATGTGGAGCGGCTTCTCGGCCGCTGCCAAACTGGTCTCCGAGAAGCTGGCCTCTTACCAGGCTGCGCGCAAAGACAGCACCAGCCTGAGCCCCGCCCGCGGGCACAGCGTCTGCTCCACCTCCAGCCTGTACCTGCAGGACCTCACCGCCGCAGCGTCCGAGTGCATCGACCCCTCAGTGGTCTTCCCCTACCCGCTCAACGACAGCAGCTCGCCCAAATCCTGTACCTCGTCCGATTCCACGGCCTTCTCTTCTTCCTCGGACTCGCTGCTGTCCTCCGAGTCCTCCCCACGGGCCACCCCTGAGCCCCTAGTGCTGCATGAAGAGACACCGCCCACCACCAGCAGCGACTCTGAAGAAGAACAAGATGATGAGGAAGAAATTGATGTGGTGTCTGTGGAAAAGAGGCAACCCCCTGCCAAGAGGTCCGAGTCAGGGTCATCCCCATCAAGAGGCCACAGCAAACCTCCACACAGCCCACTGGTCCTCAAGAGGTGCCATGTCTCTACTCACCAGCACAATTATGCAGCACCCCCCTCCACAAGGAAGGACTATCCAGCTGCCAAGAGGGCCAAGTTGGACAGTGGCAGGGTCCTGAAACAGATCAGCAACAACCGCAAATGCTCCAGCCCCAGGTCCTCAGACACCGAGGAAAACGACAAGAGGCGGACACACAACGTCTTGGAACGTCAGAGGAGAAACGAGCTGAAGCGTAGCTTTTTTGCCCTGCGCGACCAGATCCCTGAGTTGGAAAACAACGAAAAGGCCCCCAAGGTAGTTATCCTCAAAAAAGCCACCGCCTACATCCTGTCCGTTCAAGCAGATGAGCACAAACTCATCTCAGAAAAGGACTTACTGAGGAAACGGCGAGAACAGTTGAAACACAAACTCGAACAGCTTCGAAACTCTGGTGCATAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T36121-Ab | Anti-MYC monoclonal antibody |
Target Antigen | GM-Tg-g-T36121-Ag | MYC protein |
ORF Viral Vector | pGMLV000287 | Human MYC Lentivirus plasmid |
ORF Viral Vector | pGMLV000288 | Human MYC Lentivirus plasmid |
ORF Viral Vector | pGMLV000614 | Human MYC Lentivirus plasmid |
ORF Viral Vector | pGMLV002028 | Rat Myc Lentivirus plasmid |
ORF Viral Vector | pGMAD000252 | Rat Myc Adenovirus plasmid |
ORF Viral Vector | pGMAD000465 | Rat Myc Adenovirus plasmid |
ORF Viral Vector | pGMAD000804 | Human MYC Adenovirus plasmid |
ORF Viral Vector | pGMPC000377 | Human MYC Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC000706 | Rat Myc Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMAP000557 | Human MYC Adenovirus plasmid |
ORF Viral Vector | vGMLV000287 | Human MYC Lentivirus particle |
ORF Viral Vector | vGMLV000288 | Human MYC Lentivirus particle |
ORF Viral Vector | vGMLV000614 | Human MYC Lentivirus particle |
ORF Viral Vector | vGMLV002028 | Rat Myc Lentivirus particle |
ORF Viral Vector | vGMAD000252 | Rat Myc Adenovirus particle |
ORF Viral Vector | vGMAD000465 | Rat Myc Adenovirus particle |
ORF Viral Vector | vGMAD000804 | Human MYC Adenovirus particle |
ORF Viral Vector | vGMAP000557 | Human MYC Adenovirus particle |
ORF Viral Vector | pGMLV002214 | Mouse Myc Lentivirus plasmid |
ORF Viral Vector | pGMLV002221 | Human MYC Lentivirus plasmid |
ORF Viral Vector | pGMLV002481 | Mouse Myc Lentivirus plasmid |
Target information
Target ID | GM-T36121 |
Target Name | MYC |
Gene ID | 4609, 17869, 694626, 24577, 100379628, 403924, 511077, 100068097 |
Gene Symbol and Synonyms | bHLHe39,c-Myc,CMYC,mMyc,MRTL,MYC,Myc2,MYCC,Niard,Nird,RNCMYC,v-myc |
Uniprot Accession | P01106 |
Uniprot Entry Name | MYC_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Breast Cancer, Lung Cancer, Lung cancer |
Gene Ensembl | ENSG00000136997 |
Target Classification | Not Available |
This gene is a proto-oncogene and encodes a nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. The encoded protein forms a heterodimer with the related transcription factor MAX. This complex binds to the E box DNA consensus sequence and regulates the transcription of specific target genes. Amplification of this gene is frequently observed in numerous human cancers. Translocations involving this gene are associated with Burkitt lymphoma and multiple myeloma in human patients. There is evidence to show that translation initiates both from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site, resulting in the production of two isoforms with distinct N-termini. [provided by RefSeq, Aug 2017]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.