Human DLX1 ORF/cDNA clone-Adenovirus particle (BC036189)

Pre-made Human DLX1/ Adenovirus for DLX1 overexpression in-vitro and in-vivo. The DLX1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified DLX1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000470 Human DLX1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000470
Gene Name DLX1
Accession Number BC036189
Gene ID 1745
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 768 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGACCATGACCACCATGCCAGAAAGTCTCAACAGCCCCGTGTCGGGCAAGGCGGTGTTTATGGAGTTTGGGCCGCCCAACCAGCAAATGTCTCCTTCTCCCATGTCCCACGGGCACTACTCCATGCACTGTTTACACTCGGCGGGCCATTCGCAGCCCGACGGCGCCTACAGCTCAGCCTCGTCCTTCTCCCGACCGCTGGGCTACCCCTACGTCAACTCGGTCAGCAGCCACGCATCCAGCCCCTACATCAGTTCGGTGCAGTCCTACCCGGGCAGCGCCAGCCTCGCCCAGAGCCGCCTGGAGGACCCAGGGGCGGACTCGGAGAAGAGCACGGTGGTGGAAGGCGGTGAAGTGCGCTTCAATGGCAAGGGAAAAAAGATCCGTAAACCCAGGACGATTTATTGCAGTTTGCAGTTGCAGGCTTTGAACCGGAGGTTCCAGCAAACTCAGTACCTAGCTCTGCCGGAGAGGGCGGAGCTCGCGGCCTCTTTGGGACTCACACAGACTCAGGTCAAGATCTGGTTCCAAAACAAGCGATCCAAGTTCAAGAAGCTGATGAAGCAGGGTGGGGCGGCTCTGGAGGGTAGTGCGTTGGCCAACGGTCGGGCCCTGTCTGCTGGCTCCCCACCCGTGCCGCCCGGCTGGAACCCTAACTCTTCATCCGGGAAGGGCTCAGGAGGAAACGCGGGCTCCTATATCCCCAGCTACACATCGTGGTACCCTTCAGCGCACCAAGAAGCTATGCAGCAACCCCAACTTATGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    ORF Viral Vector pGMAP000470 Human DLX1 Adenovirus plasmid




    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.