Human PRKACB/MGC41879/ MGC9320 ORF/cDNA clone-Adenovirus particle (BC035058)

Pre-made Human PRKACB/MGC41879/ MGC9320 Adenovirus for PRKACB overexpression in-vitro and in-vivo. The PRKACB adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PRKACB-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.



Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000523 Human PRKACB Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000523
Gene Name PRKACB
Accession Number BC035058
Gene ID 5567
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1056 bp
Gene Alias MGC41879, MGC9320, PKACB
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGGAACGCGGCGACCGCCAAGAAAGGCAGCGAGGTGGAGAGCGTGAAAGAGTTTCTAGCCAAAGCCAAAGAAGACTTTTTGAAAAAATGGGAGAATCCAACTCAGAATAATGCCGGACTTGAAGATTTTGAAAGGAAAAAAACCCTTGGAACAGGTTCATTTGGAAGAGTCATGTTGGTAAAACACAAAGCCACTGAACAGTATTATGCCATGAAGATCTTAGATAAGCAGAAGGTTGTTAAACTGAAGCAAATAGAGCATACTTTGAATGAGAAAAGAATATTACAGGCAGTGAATTTTCCTTTCCTTGTTCGACTGGAGTATGCTTTTAAGGATAATTCTAATTTATACATGGTTATGGAATATGTCCCTGGGGGTGAAATGTTTTCACATCTAAGAAGAATTGGAAGGTTCAGTGAGCCCCATGCACGGTTCTATGCAGCTCAGATAGTGCTAACATTCGAGTACCTCAATTCACTAGACATCATCTACAGAGATCTAAAACCTGAAAATCTCTTAATTGACCATCAAGGCTATATCCAGGTCACAGACTTTGGGTTTGCCAAAAGAGTTAAAGGCAGAACTTGGACATTATGTGGAACTCCAGAGTATTTGGCTCCAGAAATAATTCTCAGCAAGGGCTACAATAAGGCAGTGGATTGGTGGGCATTAGGAGTGCTAATCTATGAAATGGCAGCTGGCTATCCCCCATTCTTTGCAGACCAACCAATTCAGATTTATGAAAAGATTGTTTCTGGAAAGGTCCGATTCCCATCCAACTTCAGTTCAGATCTCAAGGACCTTCTACGGAACCTGCTGCAGGTGGATTTGACCAAGAGATTTGGAAATCTAAAGAATGGTGTCAGTGATATAAAAACTCACAAGTGGTTTGCCACGACAGATTGGATTGCTATTTACCAGAGGAAGGTTGAAGCTCCATTCATACCAAAGTTTAGAGGCTCTGGAGATACCAGCAACTTTGATGACTATGAAGAAGAAGATATCCGTGTCTCTATAACAGAAAAATGTGCAAAAGAATTTGGTGAATTTTAA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    ORF Viral Vector pGMAP000523 Human PRKACB Adenovirus plasmid




    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.