Rat Cxcr4 ORF/cDNA clone-Adenovirus particle (BC089804)
Pre-made Rat Cxcr4/ Adenovirus for Cxcr4 overexpression in-vitro and in-vivo. The Cxcr4 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified Cxcr4-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to CXCR4/Cxcr4/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000572 | Rat Cxcr4 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000572 |
Gene Name | Cxcr4 |
Accession Number | BC089804 |
Gene ID | 60628 |
Species | Rat |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1050 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAAATATACACTTCGGATAACTACTCCGAAGAAGTAGGGTCTGGAGACTATGACTCCAACAAGGAACCCTGCTTCCGGGATGAAAACGAAAACTTCAACAGGATCTTCCTGCCCACCATCTATTTTATCATCTTCTTGACTGGCATAGTGGGCAATGGGTTGGTAATCCTGGTCATGGGTTACCAGAAGAAGCTGAGGAGCATGACAGACAAGTACCGGCTGCACCTGTCCGTGGCTGACCTCCTCTTTGTCATCACACTCCCCTTCTGGGCAGTGGACGCCATGGCTGACTGGTACTTTGGGAAATTTTTATGTAAGGCTGTGCATATCATCTACACCGTCAACCTTTACAGCAGTGTTCTCATCCTGGCCTTCATCAGCCTGGACCGCTACCTTGCCATTGTCCACGCCACCAACAGCCAGAGGCCGAGGAAGCTGCTGGCTGAAAAGGCCGTCTATGTGGGTGTCTGGATCCCCGCCCTCCTCCTGACTATCCCTGACATCATCTTCGCCGATGTCAGCCAGGGGGACGGCAGGTACATCTGTGACCGCCTTTACCCCGACAGCCTGTGGATGGTGGTGTTCCAGTTCCAGCACATCATGGTGGGTCTCATCCTGCCGGGCATCGTCATCCTGTCCTGTTACTGCATCATCATCTCCAAGCTGTCACACTCCAAGGGCCACCAGAAGCGCAAGGCCCTCAAGACTACGGTCATCCTTATCCTGGCTTTCTTTGCCTGCTGGCTACCGTATTACGTGGGGATCAGCATCGATTCCTTCATCCTTTTGGAGGTCATCAAGCAAGGATGTGAGTTCGAGAGCGTCGTGCACAAGTGGATCTCCATCACGGAGGCCCTCGCCTTCTTCCACTGTTGCCTGAACCCCATCCTCTACGCCTTCCTCGGGGCCAAATTCAAGAGCTCCGCGCAGCATGCACTCAATTCCATGAGCAGAGGCTCCAGCCTCAAGATCCTTTCCAAAGGGAAACGGGGTGGACACTCTTCCGTCTCCACAGAGTCAGAATCCTCAAGTTTTCACTCCAGCTAA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-T96079 |
Target Name | CXCR4 |
Gene ID | 7852, 12767, 707329, 60628, 493676, 119863891, 281736, 100050974 |
Gene Symbol and Synonyms | b2b220Clo,CD184,Cmkar4,CXC-R4,CXCR-4,CXCR4,D2S201E,FB22,HM89,HSY3RR,LAP-3,LAP3,LCR1,LESTR,LOC119863891,NPY3R,NPYR,NPYRL,NPYY3R,PB-CKR,PBSF/SDF-1,Sdf1r,WHIM,WHIMS,WHIMS1 |
Uniprot Accession | P61073 |
Uniprot Entry Name | CXCR4_HUMAN |
Protein Sub-location | Transmembrane Protein |
Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
Disease | Cancer |
Gene Ensembl | ENSG00000121966 |
Target Classification | Checkpoint-Immuno Oncology, GPCR, Tumor-associated antigen (TAA) |
This gene encodes a CXC chemokine receptor specific for stromal cell-derived factor-1. The protein has 7 transmembrane regions and is located on the cell surface. It acts with the CD4 protein to support HIV entry into cells and is also highly expressed in breast cancer cells. Mutations in this gene have been associated with WHIM (warts, hypogammaglobulinemia, infections, and myelokathexis) syndrome. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.