Human IL10/CSIF/ IL-10 ORF/cDNA clone-Adenovirus particle (BC104252)
Pre-made Human IL10/CSIF/ IL-10 Adenovirus for IL10 overexpression in-vitro and in-vivo. The IL10 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IL10-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to IL10/CSIF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000590 | Human IL10 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000590 |
Gene Name | IL10 |
Accession Number | BC104252 |
Gene ID | 3586 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 537 bp |
Gene Alias | CSIF, IL-10, IL10A, TGIF |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGCACAGCTCAGCACTGCTCTGTTGCCTGGTCCTCCTGACTGGGGTGAGGGCCAGCCCAGGCCAGGGCACCCAGTCTGAGAACAGCTGCACCCACTTCCCAGGCAACCTGCCTAACATGCTTCGAGATCTCCGAGATGCCTTCAGCAGAGTGAAGACTTTCTTTCAAATGAAGGATCAGCTGGACAACTTGTTGTTAAAGGAGTCCTTGCTGGAGGACTTTAAGGGTTACCTGGGTTGCCAAGCCTTGTCTGAGATGATCCAGTTTTACCTGGAGGAGGTGATGCCCCAAGCTGAGAACCAAGACCCAGACATCAAGGCGCATGTGAACTCCCTGGGGGAGAACCTGAAGACCCTCAGGCTGAGGCTACGGCGCTGTCATCGATTTCTTCCCTGTGAAAACAAGAGCAAGGCCGTGGAGCAGGTGAAGAATGCCTTTAATAAGCTCCAAGAGAAAGGCATCTACAAAGCCATGAGTGAGTTTGACATCTTCATCAACTACATAGAAGCCTACATGACAATGAAGATACGAAACTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T09092-Ab | Anti-IL10/ CSIF/ GVHDS functional antibody |
Target Antigen | GM-Tg-g-T09092-Ag | IL10 protein |
Cytokine | cks-Tg-g-GM-T09092 | interleukin 10 (IL10) protein & antibody |
ORF Viral Vector | pGMLV001166 | Human IL10 Lentivirus plasmid |
ORF Viral Vector | pGMAD000014 | Human IL10 Adenovirus plasmid |
ORF Viral Vector | pGMAP000484 | Human IL10 Adenovirus plasmid |
ORF Viral Vector | pGMAP000590 | Human IL10 Adenovirus plasmid |
ORF Viral Vector | pGMLP-IL-013 | Human IL10 Lentivirus plasmid |
ORF Viral Vector | pGMAP-IL-096 | Human IL10 Adenovirus plasmid |
ORF Viral Vector | vGMLV001166 | Human IL10 Lentivirus particle |
ORF Viral Vector | vGMAD000014 | Human IL10 Adenovirus particle |
ORF Viral Vector | vGMAP000484 | Human IL10 Adenovirus particle |
ORF Viral Vector | vGMAP000590 | Human IL10 Adenovirus particle |
ORF Viral Vector | vGMLP-IL-013 | Human IL10 Lentivirus particle |
ORF Viral Vector | vGMAP-IL-096 | Human IL10 Adenovirus particle |
ORF Viral Vector | pGMLV002097 | Mouse Il10 Lentivirus plasmid |
Target information
Target ID | GM-T09092 |
Target Name | IL10 |
Gene ID | 3586, 16153, 694931, 25325, 493683, 403628, 281246, 100034187 |
Gene Symbol and Synonyms | CSIF,GVHDS,If2a,IL-10,IL10,IL10A,IL10X,TGIF |
Uniprot Accession | P22301 |
Uniprot Entry Name | IL10_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Immuno-oncology Target, Cytokine Target |
Disease | Ovary Cancer, metastases, asthma, Malignant neoplasm of bladder |
Gene Ensembl | ENSG00000136634 |
Target Classification | Checkpoint-Immuno Oncology |
The protein encoded by this gene is a cytokine produced primarily by monocytes and to a lesser extent by lymphocytes. This cytokine has pleiotropic effects in immunoregulation and inflammation. It down-regulates the expression of Th1 cytokines, MHC class II Ags, and costimulatory molecules on macrophages. It also enhances B cell survival, proliferation, and antibody production. This cytokine can block NF-kappa B activity, and is involved in the regulation of the JAK-STAT signaling pathway. Knockout studies in mice suggested the function of this cytokine as an essential immunoregulator in the intestinal tract. Mutations in this gene are associated with an increased susceptibility to HIV-1 infection and rheumatoid arthritis. [provided by RefSeq, May 2020]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.