Mouse Tnfsf8/CD153/ Cd30l ORF/cDNA clone-Lentivirus particle (NM_009403)

Pre-made Mouse Tnfsf8/CD153/ Cd30l Lentiviral expression plasmid for Tnfsf8 lentivirus packaging, Tnfsf8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLPm000510 Mouse Tnfsf8 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLPm000510
Gene Name Tnfsf8
Accession Number NM_009403
Gene ID 21949
Species Mouse
Product Type Lentivirus particle (overexpression)
Insert Length 720 bp
Gene Alias CD153, Cd30l, CD30LG, Tnlg3a
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGAGCCAGGGCTGCAACAAGCAGGCAGCTGTGGGGCTCCTTCCCCTGACCCAGCCATGCAGGTGCAGCCCGGCTCGGTAGCCAGCCCCTGGAGAAGCACGAGGCCCTGGAGAAGCACAAGTCGCAGCTACTTCTACCTCAGCACCACCGCACTGGTGTGCCTTGTTGTGGCAGTGGCGATCATTCTGGTACTGGTAGTCCAGAAAAAGGACTCCACTCCAAATACAACTGAGAAGGCCCCCCTTAAAGGAGGAAATTGCTCAGAGGATCTCTTCTGTACCCTGAAAAGTACTCCATCCAAGAAGTCATGGGCCTACCTCCAAGTGTCAAAGCATCTCAACAATACCAAACTGTCATGGAACGAAGATGGCACCATCCACGGACTCATATACCAGGACGGGAACCTGATAGTCCAATTCCCTGGCTTGTACTTCATCGTTTGCCAACTGCAGTTCCTCGTGCAGTGCTCAAATCATTCTGTGGACCTGACATTGCAGCTCCTCATCAATTCCAAGATCAAAAAGCAGACGTTGGTAACAGTGTGTGAGTCTGGAGTTCAGAGTAAGAACATCTACCAGAATCTCTCTCAGTTTTTGCTGCATTACTTACAGGTCAACTCTACCATATCAGTCAGGGTGGATAATTTCCAGTATGTGGATACAAACACTTTCCCTCTTGATAATGTGCTATCCGTCTTCTTATATAGTAGCTCAGACTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    ORF Viral Vector pGMLPm000510 Mouse Tnfsf8 Lentivirus plasmid




    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.