Rat Ntf3 ORF/cDNA clone-Lentivirus particle (NM_031073)

Pre-made Rat Ntf3/ Lentiviral expression plasmid for Ntf3 lentivirus packaging, Ntf3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to NTF3/Ntf3/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLPm001258 Rat Ntf3 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLPm001258
Gene Name Ntf3
Accession Number NM_031073
Gene ID 81737
Species Rat
Product Type Lentivirus particle (overexpression)
Insert Length 816 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGTTACTTCTGCCACGATCTTACAGGTGAACAAGGTGATGTCCATCTTGTTTTATGTGATATTTCTTGCTTATCTCCGTGGCATCCAAGGCAACAACATGGATCAAAGGAGTTTGCCAGAAGACTCTCTCAATTCCCTCATTATCAAGTTGATCCAGGCGGATATCTTGAAAAACAAGCTCTCCAAGCAGATGGTAGATGTTAAGGAAAATTACCAGAGCACCCTGCCCAAAGCAGAGGCACCCAGAGAACCAGAGCAGGGAGAGGCCACCAGGTCAGAATTCCAGCCGATGATTGCAACAGACACAGAACTACTACGGCAACAGAGACGCTACAATTCACCCCGGGTCCTGCTGAGTGACAGCACCCCTTTGGAGCCCCCTCCCTTATATCTAATGGAAGATTATGTGGGCAACCCGGTGGTAACCAATAGAACATCACCACGGAGGAAACGCTATGCAGAGCATAAGAGTCACCGAGGAGAGTACTCAGTGTGTGACAGTGAGAGCCTGTGGGTGACCGACAAGTCCTCAGCCATTGACATTCGGGGACACCAGGTTACAGTGTTGGGAGAGATCAAAACCGGCAACTCTCCTGTGAAACAATATTTTTATGAAACGAGGTGTAAAGAAGCCAGGCCAGTCAAAAACGGTTGCAGGGGGATTGATGACAAACACTGGAACTCTCAGTGCAAAACGTCGCAAACCTACGTCCGAGCACTGACTTCAGAAAACAACAAACTCGTAGGCTGGCGCTGGATACGAATAGACACTTCCTGTGTGTGTGCCTTGTCAAGAAAAATCGGAAGAACATGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T32855-Ab Anti-NTF3/ HDNF/ NGF-2 functional antibody
    Target Antigen GM-Tg-g-T32855-Ag NTF3 protein
    ORF Viral Vector pGMAD000046 Human NTF3 Adenovirus plasmid
    ORF Viral Vector pGMAP000383 Human NTF3 Adenovirus plasmid
    ORF Viral Vector pGMLPm001258 Rat Ntf3 Lentivirus plasmid
    ORF Viral Vector vGMAD000046 Human NTF3 Adenovirus particle
    ORF Viral Vector vGMAP000383 Human NTF3 Adenovirus particle
    ORF Viral Vector vGMLPm001258 Rat Ntf3 Lentivirus particle
    ORF Viral Vector pGMLV002188 Human NTF3 Lentivirus plasmid


    Target information

    Target ID GM-T32855
    Target Name NTF3
    Gene ID 4908, 18205, 721988, 81737, 493963, 486731, 532393, 100051839
    Gene Symbol and Synonyms HDNF,NGF-2,NGF2,NT-3,NT3,Ntf-3,NTF3
    Uniprot Accession P20783
    Uniprot Entry Name NTF3_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Schizophrenia
    Gene Ensembl ENSG00000185652
    Target Classification Not Available

    The protein encoded by this gene is a member of the neurotrophin family, that controls survival and differentiation of mammalian neurons. This protein is closely related to both nerve growth factor and brain-derived neurotrophic factor. It may be involved in the maintenance of the adult nervous system, and may affect development of neurons in the embryo when it is expressed in human placenta. NTF3-deficient mice generated by gene targeting display severe movement defects of the limbs. The mature peptide of this protein is identical in all mammals examined including human, pig, rat and mouse. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.