Human CDKN2A/ARF/ CDK4I ORF/cDNA clone-Lentivirus particle (NM_000077.5)
Pre-made Human CDKN2A/ARF/ CDK4I Lentiviral expression plasmid for CDKN2A lentivirus packaging, CDKN2A lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CDKN2A/ARF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV001697 | Human CDKN2A Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV001697 |
Gene Name | CDKN2A |
Accession Number | NM_000077.5 |
Gene ID | 1029 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 471 bp |
Gene Alias | ARF, CDK4I, CDKN2, CMM2, INK4, INK4A, MLM, MTS-1, MTS1, P14, P14ARF, P16, P16-INK4A, P16INK4, P16INK4A, P19, P19ARF, TP16 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAGCCGGCGGCGGGGAGCAGCATGGAGCCTTCGGCTGACTGGCTGGCCACGGCCGCGGCCCGGGGTCGGGTAGAGGAGGTGCGGGCGCTGCTGGAGGCGGGGGCGCTGCCCAACGCACCGAATAGTTACGGTCGGAGGCCGATCCAGGTCATGATGATGGGCAGCGCCCGAGTGGCGGAGCTGCTGCTGCTCCACGGCGCGGAGCCCAACTGCGCCGACCCCGCCACTCTCACCCGACCCGTGCACGACGCTGCCCGGGAGGGCTTCCTGGACACGCTGGTGGTGCTGCACCGGGCCGGGGCGCGGCTGGACGTGCGCGATGCCTGGGGCCGTCTGCCCGTGGACCTGGCTGAGGAGCTGGGCCATCGCGATGTCGCACGGTACCTGCGCGCGGCTGCGGGGGGCACCAGAGGCAGTAACCATGCCCGCATAGATGCCGCGGAAGGTCCCTCAGACATCCCCGATTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T16452-Ab | Anti-CDKN2A monoclonal antibody |
Target Antigen | GM-Tg-g-T16452-Ag | CDKN2A protein |
ORF Viral Vector | pGMLV000916 | Human CDKN2A Lentivirus plasmid |
ORF Viral Vector | pGMLV001697 | Human CDKN2A Lentivirus plasmid |
ORF Viral Vector | pGMAD000002 | Human CDKN2A Adenovirus plasmid |
ORF Viral Vector | vGMLV000916 | Human CDKN2A Lentivirus particle |
ORF Viral Vector | vGMLV001697 | Human CDKN2A Lentivirus particle |
ORF Viral Vector | vGMAD000002 | Human CDKN2A Adenovirus particle |
Target information
Target ID | GM-T16452 |
Target Name | CDKN2A |
Gene ID | 1029 |
Gene Symbol and Synonyms | ARF,CDK4I,CDKN2,CDKN2A,CMM2,INK4,INK4A,MLM,MTS-1,MTS1,P14,P14ARF,P16,P16-INK4A,P16INK4,P16INK4A,P19,P19ARF,TP16 |
Uniprot Accession | P42771, Q8N726 |
Uniprot Entry Name | CDN2A_HUMAN,ARF_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Prostate Cancer, Skin cancer - melanoma |
Gene Ensembl | ENSG00000147889 |
Target Classification | Not Available |
This gene generates several transcript variants which differ in their first exons. At least three alternatively spliced variants encoding distinct proteins have been reported, two of which encode structurally related isoforms known to function as inhibitors of CDK4 kinase. The remaining transcript includes an alternate first exon located 20 Kb upstream of the remainder of the gene; this transcript contains an alternate open reading frame (ARF) that specifies a protein which is structurally unrelated to the products of the other variants. This ARF product functions as a stabilizer of the tumor suppressor protein p53 as it can interact with, and sequester, the E3 ubiquitin-protein ligase MDM2, a protein responsible for the degradation of p53. In spite of the structural and functional differences, the CDK inhibitor isoforms and the ARF product encoded by this gene, through the regulatory roles of CDK4 and p53 in cell cycle G1 progression, share a common functionality in cell cycle G1 control. This gene is frequently mutated or deleted in a wide variety of tumors, and is known to be an important tumor suppressor gene. [provided by RefSeq, Sep 2012]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.