Human BIRC5/EPR-1 ORF/cDNA clone-Adenovirus plasmid (BC008718)

Pre-made Human BIRC5/EPR-1 adenoviral expression plasmid for BIRC5 adenovirus packaging, BIRC5 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to BIRC5/EPR-1 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000202 Human BIRC5 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000202
Gene Name BIRC5
Accession Number BC008718
Gene ID 332
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 429 bp
Gene Alias EPR-1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCTACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAGGCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGCTTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATAGAGGAACATAAAAAGCATTCGTCCGGTTGCGCTTTCCTTTCTGTCAAGAAGCAGTTTGAAGAATTAACCCTTGGTGAATTTTTGAAACTGGACAGAGAAAGAGCCAAGAACAAAATTGCAAAGGAAACCAACAATAAGAAGAAAGAATTTGAGGAAACTGCGAAGAAAGTGCGCCGTGCCATCGAGCAGCTGGCTGCCATGGATTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T02677-Ab Anti-BIRC5 monoclonal antibody
    Target Antigen GM-Tg-g-T02677-Ag BIRC5 protein
    ORF Viral Vector pGMAP000202 Human BIRC5 Adenovirus plasmid
    ORF Viral Vector vGMAP000202 Human BIRC5 Adenovirus particle


    Target information

    Target ID GM-T02677
    Target Name BIRC5
    Gene ID 332, 11799, 709565, 64041, 493835, 442936, 414925, 100050808
    Gene Symbol and Synonyms AAC-11,AP14,API4,BIRC5,EPR-1,survivin40,TIAP
    Uniprot Accession O15392
    Uniprot Entry Name BIRC5_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Breast Cancer, Malignant neoplasm of bladder
    Gene Ensembl ENSG00000089685
    Target Classification Checkpoint-Immuno Oncology

    This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2011]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.