Human ERG/erg-3/p55 ORF/cDNA clone-Adenovirus plasmid (BC040168)

Cat. No.: pGMAP000350
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ERG/erg-3/p55 adenoviral expression plasmid for ERG adenovirus packaging, ERG adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to ERG/erg-3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000350
Gene Name ERG
Accession Number BC040168
Gene ID 2078
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 1440 bp
Gene Alias erg-3,p55
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCAGCACTATTAAGGAAGCCTTATCAGTTGTGAGTGAGGACCAGTCGTTGTTTGAGTGTGCCTACGGAACGCCACACCTGGCTAAGACAGAGATGACCGCGTCCTCCTCCAGCGACTATGGACAGACTTCCAAGATGAGCCCACGCGTCCCTCAGCAGGATTGGCTGTCTCAACCCCCAGCCAGGGTCACCATCAAAATGGAATGTAACCCTAGCCAGGTGAATGGCTCAAGGAACTCTCCTGATGAATGCAGTGTGGCCAAAGGCGGGAAGATGGTGGGCAGCCCAGACACCGTTGGGATGAACTACGGCAGCTACATGGAGGAGAAGCACATGCCACCCCCAAACATGACCACGAACGAGCGCAGAGTTATCGTGCCAGCAGATCCTACGCTATGGAGTACAGACCATGTGCGGCAGTGGCTGGAGTGGGCGGTGAAAGAATATGGCCTTCCAGACGTCAACATCTTGTTATTCCAGAACATCGATGGGAAGGAACTGTGCAAGATGACCAAGGACGACTTCCAGAGGCTCACCCCCAGCTACAATGCCGACATCCTTCTCTCACATCTCCACTACCTCAGAGAGACTCCTCTTCCACATTTGACTTCAGATGATGTTGATAAAGCCTTACAAAACTCTCCACGGTTAATGCATGCTAGAAACACAGGGGGTGCAGCTTTTATTTTCCCAAATACTTCAGTATATCCTGAAGCTACGCAAAGAATTACAACTAGGCCAGATTTACCATATGAGCCCCCCAGGAGATCAGCCTGGACCGGTCACGGCCACCCCACGCCCCAGTCGAAAGCTGCTCAACCATCTCCTTCCACAGTGCCCAAAACTGAAGACCAGCGTCCTCAGTTAGATCCTTATCAGATTCTTGGACCAACAAGTAGCCGCCTTGCAAATCCAGGCAGTGGCCAGATCCAGCTTTGGCAGTTCCTCCTGGAGCTCCTGTCGGACAGCTCCAACTCCAGCTGCATCACCTGGGAAGGCACCAACGGGGAGTTCAAGATGACGGATCCCGACGAGGTGGCCCGGCGCTGGGGAGAGCGGAAGAGCAAACCCAACATGAACTACGATAAGCTCAGCCGCGCCCTCCGTTACTACTATGACAAGAACATCATGACCAAGGTCCATGGGAAGCGCTACGCCTACAAGTTCGACTTCCACGGGATCGCCCAGGCCCTCCAGCCCCACCCCCCGGAGTCATCTCTGTACAAGTACCCCTCAGACCTCCCGTACATGGGCTCCTATCACGCCCACCCACAGAAGATGAACTTTGTGGCGCCCCACCCTCCAGCCCTCCCCGTGACATCTTCCAGTTTTTTTGCTGCCCCAAACCCATACTGGAATTCACCAACTGGGGGTATATACCCCAACACTAGGCTCCCCACCAGCCATATGCCTTCTCATCTGGGCACTTACTACTAA
ORF Protein Sequence MASTIKEALSVVSEDQSLFECAYGTPHLAKTEMTASSSSDYGQTSKMSPRVPQQDWLSQPPARVTIKMECNPSQVNGSRNSPDECSVAKGGKMVGSPDTVGMNYGSYMEEKHMPPPNMTTNERRVIVPADPTLWSTDHVRQWLEWAVKEYGLPDVNILLFQNIDGKELCKMTKDDFQRLTPSYNADILLSHLHYLRETPLPHLTSDDVDKALQNSPRLMHARNTGGAAFIFPNTSVYPEATQRITTRPDLPYEPPRRSAWTGHGHPTPQSKAAQPSPSTVPKTEDQRPQLDPYQILGPTSSRLANPGSGQIQLWQFLLELLSDSSNSSCITWEGTNGEFKMTDPDEVARRWGERKSKPNMNYDKLSRALRYYYDKNIMTKVHGKRYAYKFDFHGIAQALQPHPPESSLYKYPSDLPYMGSYHAHPQKMNFVAPHPPALPVTSSSFFAAPNPYWNSPTGGIYPNTRLPTSHMPSHLGTYY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IO040-Ab Anti-ERG monoclonal antibody
    Target Antigen GM-Tg-g-IO040-Ag ERG protein
    ORF Viral Vector pGMLP004123 Human ERG Lentivirus plasmid
    ORF Viral Vector pGMAP000350 Human ERG Adenovirus plasmid
    ORF Viral Vector vGMLP004123 Human ERG Lentivirus particle
    ORF Viral Vector vGMAP000350 Human ERG Adenovirus particle


    Target information

    Target ID GM-IO040
    Target Name ERG
    Gene ID 2078, 13876, 693300, 170909, 101099895, 487760, 535231, 100051563
    Gene Symbol and Synonyms D030036I24Rik,ERG,erg-3,p55
    Uniprot Accession P11308
    Uniprot Entry Name ERG_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Prostate Cancer
    Gene Ensembl ENSG00000157554
    Target Classification Checkpoint-Immuno Oncology, Ion Channel

    This gene encodes a member of the erythroblast transformation-specific (ETS) family of transcriptions factors. All members of this family are key regulators of embryonic development, cell proliferation, differentiation, angiogenesis, inflammation, and apoptosis. The protein encoded by this gene is mainly expressed in the nucleus. It contains an ETS DNA-binding domain and a PNT (pointed) domain which is implicated in the self-association of chimeric oncoproteins. This protein is required for platelet adhesion to the subendothelium, inducing vascular cell remodeling. It also regulates hematopoesis, and the differentiation and maturation of megakaryocytic cells. This gene is involved in chromosomal translocations, resulting in different fusion gene products, such as TMPSSR2-ERG and NDRG1-ERG in prostate cancer, EWS-ERG in Ewing's sarcoma and FUS-ERG in acute myeloid leukemia. More than two dozens of transcript variants generated from combinatorial usage of three alternative promoters and multiple alternative splicing events have been reported, but the full-length nature of many of these variants has not been determined. [provided by RefSeq, Apr 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.