Human TFF1/D21S21/HP1.A ORF/cDNA clone-Adenovirus plasmid (BC032811)

Cat. No.: pGMAP000440
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TFF1/D21S21/HP1.A adenoviral expression plasmid for TFF1 adenovirus packaging, TFF1 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to TFF1/D21S21 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMAP000440
Gene Name TFF1
Accession Number BC032811
Gene ID 7031
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 255 bp
Gene Alias D21S21,HP1.A,HPS2,pNR-2,pS2
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCACCATGGAGAACAAGGTGATCTGCGCCCTGGTCCTGGTGTCCATGCTGGCCCTCGGCACCCTGGCCGAGGCCCAGACAGAGACGTGTACAGTGGCCCCCCGTGAAAGACAGAATTGTGGTTTTCCTGGTGTCACGCCCTCCCAGTGTGCAAATAAGGGCTGCTGTTTCGACGACACCGTTCGTGGGGTCCCCTGGTGCTTCTATCCTAATACCATCGACGTCCCTCCAGAAGAGGAGTGTGAATTTTAG
ORF Protein Sequence MATMENKVICALVLVSMLALGTLAEAQTETCTVAPRERQNCGFPGVTPSQCANKGCCFDDTVRGVPWCFYPNTIDVPPEEECEF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T38159-Ab Anti-TFF1/ BCEI/ D21S21 functional antibody
    Target Antigen GM-Tg-g-T38159-Ag TFF1 protein
    ORF Viral Vector pGMLP000538 Human TFF1 Lentivirus plasmid
    ORF Viral Vector pGMAP000440 Human TFF1 Adenovirus plasmid
    ORF Viral Vector vGMLP000538 Human TFF1 Lentivirus particle
    ORF Viral Vector vGMAP000440 Human TFF1 Adenovirus particle


    Target information

    Target ID GM-T38159
    Target Name TFF1
    Gene ID 7031, 21784, 100423966, 117270, 100170654, 403491, 100301237, 100629635
    Gene Symbol and Synonyms BCEI,D21S21,HP1.A,HPS2,pNR-2,pS2,TFF1
    Uniprot Accession P04155
    Uniprot Entry Name TFF1_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Diagnostics Biomarker
    Disease Cancer
    Gene Ensembl ENSG00000160182
    Target Classification Tumor-associated antigen (TAA)

    Members of the trefoil family are characterized by having at least one copy of the trefoil motif, a 40-amino acid domain that contains three conserved disulfides. They are stable secretory proteins expressed in gastrointestinal mucosa. Their functions are not defined, but they may protect the mucosa from insults, stabilize the mucus layer, and affect healing of the epithelium. This gene, which is expressed in the gastric mucosa, has also been studied because of its expression in human tumors. This gene and two other related trefoil family member genes are found in a cluster on chromosome 21. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.