Human BGLAP/BGP/ OC ORF/cDNA clone-Adenovirus plasmid (BC113432)

Pre-made Human BGLAP/BGP/ OC adenoviral expression plasmid for BGLAP adenovirus packaging, BGLAP adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to BGLAP/BGP products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000480 Human BGLAP Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000480
Gene Name BGLAP
Accession Number BC113432
Gene ID 632
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 303 bp
Gene Alias BGP, OC, PMF1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAGAGCCCTCACACTCCTCGCCCTATTGGCCCTGGCCGCACTTTGCATCGCTGGCCAGGCAGGTGCGAAGCCCAGCGGTGCAGAGTCCAGCAAAGGTGCAGCCTTTGTGTCCAAGCAGGAGGGCAGCGAGGTAGTGAAGAGACCCAGGCGCTACCTGTATCAATGGCTGGGAGCCCCAGTCCCCTACCCGGATCCCCTGGAGCCCAGGAGGGAGGTGTGTGAGCTCAATCCGGACTGTGACGAGTTGGCTGACCACATCGGCTTTCAGGAGGCCTATCGGCGCTTCTACGGCCCGGTCTAG

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE0683-Ab Anti-OSTCN/ OSTCN_HOMNE/ BGLAP functional antibody
    Target Antigen GM-Tg-g-SE0683-Ag BGLAP protein
    ORF Viral Vector pGMLP000550 Human BGLAP Lentivirus plasmid
    ORF Viral Vector pGMAP000480 Human BGLAP Adenovirus plasmid
    ORF Viral Vector vGMLP000550 Human BGLAP Lentivirus particle
    ORF Viral Vector vGMAP000480 Human BGLAP Adenovirus particle


    Target information

    Target ID GM-SE0683
    Target Name BGLAP
    Gene ID 632, 12096, 718296, 25295, 101085947, 403762, 281646
    Gene Symbol and Synonyms BGLAP,Bglap1,Bglap2,BGP,Bgpr,Bgpra,GLA,mOC-A,OC,OCN,OG1
    Uniprot Accession P02818, P84351
    Uniprot Entry Name OSTCN_HUMAN,OSTCN_HOMNE
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Breast Cancer, bone formation, Disturbances in bone turnover, glucocorticoid-induced osteopenia, growth
    Gene Ensembl ENSG00000242252
    Target Classification Not Available

    This gene encodes a highly abundant bone protein secreted by osteoblasts that regulates bone remodeling and energy metabolism. The encoded protein contains a Gla (gamma carboxyglutamate) domain, which functions in binding to calcium and hydroxyapatite, the mineral component of bone. Serum osteocalcin levels may be negatively correlated with metabolic syndrome. Read-through transcription exists between this gene and the neighboring upstream gene, PMF1 (polyamine-modulated factor 1), but the encoded protein only shows sequence identity with the upstream gene product. [provided by RefSeq, Jun 2015]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.