Human BGLAP/BGP/ OC ORF/cDNA clone-Adenovirus particle (BC113432)
Pre-made Human BGLAP/BGP/ OC Adenovirus for BGLAP overexpression in-vitro and in-vivo. The BGLAP adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified BGLAP-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to BGLAP/BGP products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000480 | Human BGLAP Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000480 |
Gene Name | BGLAP |
Accession Number | BC113432 |
Gene ID | 632 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 303 bp |
Gene Alias | BGP, OC, PMF1 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGAGAGCCCTCACACTCCTCGCCCTATTGGCCCTGGCCGCACTTTGCATCGCTGGCCAGGCAGGTGCGAAGCCCAGCGGTGCAGAGTCCAGCAAAGGTGCAGCCTTTGTGTCCAAGCAGGAGGGCAGCGAGGTAGTGAAGAGACCCAGGCGCTACCTGTATCAATGGCTGGGAGCCCCAGTCCCCTACCCGGATCCCCTGGAGCCCAGGAGGGAGGTGTGTGAGCTCAATCCGGACTGTGACGAGTTGGCTGACCACATCGGCTTTCAGGAGGCCTATCGGCGCTTCTACGGCCCGGTCTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-SE0683-Ab | Anti-OSTCN/ OSTCN_HOMNE/ BGLAP functional antibody |
Target Antigen | GM-Tg-g-SE0683-Ag | BGLAP protein |
ORF Viral Vector | pGMLP000550 | Human BGLAP Lentivirus plasmid |
ORF Viral Vector | pGMAP000480 | Human BGLAP Adenovirus plasmid |
ORF Viral Vector | vGMLP000550 | Human BGLAP Lentivirus particle |
ORF Viral Vector | vGMAP000480 | Human BGLAP Adenovirus particle |
Target information
Target ID | GM-SE0683 |
Target Name | BGLAP |
Gene ID | 632, 12096, 718296, 25295, 101085947, 403762, 281646 |
Gene Symbol and Synonyms | BGLAP,Bglap1,Bglap2,BGP,Bgpr,Bgpra,GLA,mOC-A,OC,OCN,OG1 |
Uniprot Accession | P02818, P84351 |
Uniprot Entry Name | OSTCN_HUMAN,OSTCN_HOMNE |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Not Available |
Disease | Breast Cancer, bone formation, Disturbances in bone turnover, glucocorticoid-induced osteopenia, growth |
Gene Ensembl | ENSG00000242252 |
Target Classification | Not Available |
This gene encodes a highly abundant bone protein secreted by osteoblasts that regulates bone remodeling and energy metabolism. The encoded protein contains a Gla (gamma carboxyglutamate) domain, which functions in binding to calcium and hydroxyapatite, the mineral component of bone. Serum osteocalcin levels may be negatively correlated with metabolic syndrome. Read-through transcription exists between this gene and the neighboring upstream gene, PMF1 (polyamine-modulated factor 1), but the encoded protein only shows sequence identity with the upstream gene product. [provided by RefSeq, Jun 2015]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.