Human RPL35 ORF/cDNA clone-Adenovirus plasmid (BC000348)
Pre-made Human RPL35/ adenoviral expression plasmid for RPL35 adenovirus packaging, RPL35 adenovirus.
Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.
Go
to RPL35/ products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Plasmid Grade | Plasmid quantity |
---|---|---|---|
pGMAP000518 | Human RPL35 Adenovirus plasmid | Research Grade | 10mg, 50mg, 100mg, 500mg, >1g |
GMP-like Grade | 10mg, 50mg, 100mg, 500mg, >1g | ||
High Quality (HQ) Grade | |||
Seed | 5ug |
Product Description
Catalog ID | pGMAP000518 |
Gene Name | RPL35 |
Accession Number | BC000348 |
Gene ID | 11224 |
Species | Human |
Product Type | Adenovirus plasmid (overexpression) |
Insert Length | 372 bp |
Gene Alias | |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGAAGGAGGAGCTGCTGAAACAGCTGGACGACCTGAAGGTGGAGCTGTCCCAGCTGCGCGTCGCCAAAGTGACAGGCGGTGCGGCCTCCAAGCTCTCTAAGATCCGAGTCGTCCGGAAATCCATTGCCCGTGTTCTCACAGTTATTAACCAGACTCAGAAAGAAAACCTCAGGAAATTCTACAAGGGCAAGAAGTACAAGCCCCTGGACCTGCGGCCTAAGAAGACACGTGCCATGCGCCGCCGGCTCAACAAGCACGAGGAGAACCTGAAGACCAAGAAGCAGCAGCGGAAGGAGCGGCTGTACCCGCTGCGGAAGTACGCGGTCAAGGCCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP1546-Ab | Anti-RPL35 monoclonal antibody |
Target Antigen | GM-Tg-g-IP1546-Ag | RPL35 protein |
ORF Viral Vector | pGMAP000518 | Human RPL35 Adenovirus plasmid |
ORF Viral Vector | vGMAP000518 | Human RPL35 Adenovirus particle |
Target information
Target ID | GM-IP1546 |
Target Name | RPL35 |
Gene ID | 11224, 66489, 693604, 296709, 101081766, 480729, 515534, 100070944 |
Gene Symbol and Synonyms | 2410039E09Rik,DBA19,L35,RPL35,uL29 |
Uniprot Accession | P42766 |
Uniprot Entry Name | RL35_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000136942 |
Target Classification | Not Available |
Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L29P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.