Human RPL35 ORF/cDNA clone-Adenovirus plasmid (BC000348)

Pre-made Human RPL35/ adenoviral expression plasmid for RPL35 adenovirus packaging, RPL35 adenovirus.

Our GM-Adenovirus vector is optimized with the GMVC-modified Adeasy adenovirus packaging system. Find more about the GMVC-modified adenovirus packaging system.

Target products collectionGo to RPL35/ products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMAP000518 Human RPL35 Adenovirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMAP000518
Gene Name RPL35
Accession Number BC000348
Gene ID 11224
Species Human
Product Type Adenovirus plasmid (overexpression)
Insert Length 372 bp
Gene Alias
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGGCCAAGATCAAGGCTCGAGATCTTCGCGGGAAGAAGAAGGAGGAGCTGCTGAAACAGCTGGACGACCTGAAGGTGGAGCTGTCCCAGCTGCGCGTCGCCAAAGTGACAGGCGGTGCGGCCTCCAAGCTCTCTAAGATCCGAGTCGTCCGGAAATCCATTGCCCGTGTTCTCACAGTTATTAACCAGACTCAGAAAGAAAACCTCAGGAAATTCTACAAGGGCAAGAAGTACAAGCCCCTGGACCTGCGGCCTAAGAAGACACGTGCCATGCGCCGCCGGCTCAACAAGCACGAGGAGAACCTGAAGACCAAGAAGCAGCAGCGGAAGGAGCGGCTGTACCCGCTGCGGAAGTACGCGGTCAAGGCCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1546-Ab Anti-RPL35 monoclonal antibody
    Target Antigen GM-Tg-g-IP1546-Ag RPL35 protein
    ORF Viral Vector pGMAP000518 Human RPL35 Adenovirus plasmid
    ORF Viral Vector vGMAP000518 Human RPL35 Adenovirus particle


    Target information

    Target ID GM-IP1546
    Target Name RPL35
    Gene ID 11224, 66489, 693604, 296709, 101081766, 480729, 515534, 100070944
    Gene Symbol and Synonyms 2410039E09Rik,DBA19,L35,RPL35,uL29
    Uniprot Accession P42766
    Uniprot Entry Name RL35_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000136942
    Target Classification Not Available

    Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein belongs to the L29P family of ribosomal proteins. It is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.