Human FTH1/FHC/FTH ORF/cDNA clone-Lentivirus plasmid (NM_002032)
Cat. No.: pGMLV000308
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human FTH1/FHC/FTH Lentiviral expression plasmid for FTH1 lentivirus packaging, FTH1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
FTH1/FHC products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
Catalog ID | pGMLV000308 |
Gene Name | FTH1 |
Accession Number | NM_002032 |
Gene ID | 2495 |
Species | Human |
Product Type | Lentivirus plasmid (overexpression) |
Insert Length | 552 bp |
Gene Alias | FHC,FTH,FTHL6,HFE5,PIG15,PLIF |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
ORF Nucleotide Sequence | ATGACGACCGCGTCCACCTCGCAGGTGCGCCAGAACTACCACCAGGACTCAGAGGCCGCCATCAACCGCCAGATCAACCTGGAGCTCTACGCCTCCTACGTTTACCTGTCCATGTCTTACTACTTTGACCGCGATGATGTGGCTTTGAAGAACTTTGCCAAATACTTTCTTCACCAATCTCATGAGGAGAGGGAACATGCTGAGAAACTGATGAAGCTGCAGAACCAACGAGGTGGCCGAATCTTCCTTCAGGATATCAAGAAACCAGACTGTGATGACTGGGAGAGCGGGCTGAATGCAATGGAGTGTGCATTACATTTGGAAAAAAATGTGAATCAGTCACTACTGGAACTGCACAAACTGGCCACTGACAAAAATGACCCCCATTTGTGTGACTTCATTGAGACACATTACCTGAATGAGCAGGTGAAAGCCATCAAAGAATTGGGTGACCACGTGACCAACTTGCGCAAGATGGGAGCGCCCGAATCTGGCTTGGCGGAATATCTCTTTGACAAGCACACCCTGGGAGACAGTGATAATGAAAGCTAA |
ORF Protein Sequence | MTTASTSQVRQNYHQDSEAAINRQINLELYASYVYLSMSYYFDRDDVALKNFAKYFLHQSHEEREHAEKLMKLQNQRGGRIFLQDIKKPDCDDWESGLNAMECALHLEKNVNQSLLELHKLATDKNDPHLCDFIETHYLNEQVKAIKELGDHVTNLRKMGAPESGLAEYLFDKHTLGDSDNES |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T89873-Ab | Anti-FTH1 monoclonal antibody |
Target Antigen | GM-Tg-g-T89873-Ag | FTH1 protein |
ORF Viral Vector | pGMLV000307 | Human FTH1 Lentivirus plasmid |
ORF Viral Vector | pGMLV000308 | Human FTH1 Lentivirus plasmid |
ORF Viral Vector | pGMAP000151 | Human FTH1 Adenovirus plasmid |
ORF Viral Vector | pGMPC000822 | Human FTH1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMPC001052 | Human FTH1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | vGMLV000307 | Human FTH1 Lentivirus particle |
ORF Viral Vector | vGMLV000308 | Human FTH1 Lentivirus particle |
ORF Viral Vector | vGMAP000151 | Human FTH1 Adenovirus particle |
Target information
Target ID | GM-T89873 |
Target Name | FTH1 |
Gene ID | 2495, 14319, 574118, 25319, 654516, 403631, 281173, 100062811 |
Gene Symbol and Synonyms | FHC,FTH,FTH1,FTHL6,HFE5,HFt,LOC403631,MFH,PIG15,PLIF |
Uniprot Accession | P02794 |
Uniprot Entry Name | FRIH_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000167996 |
Target Classification | Not Available |
This gene encodes the heavy subunit of ferritin, the major intracellular iron storage protein in prokaryotes and eukaryotes. It is composed of 24 subunits of the heavy and light ferritin chains. Variation in ferritin subunit composition may affect the rates of iron uptake and release in different tissues. A major function of ferritin is the storage of iron in a soluble and nontoxic state. Defects in ferritin proteins are associated with several neurodegenerative diseases. This gene has multiple pseudogenes. Several alternatively spliced transcript variants have been observed, but their biological validity has not been determined. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.