Human MKRN1/RNF61 ORF/cDNA clone-Lentivirus plasmid (NM_013446.4)

Cat. No.: pGMLV000773
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human MKRN1/RNF61 Lentiviral expression plasmid for MKRN1 lentivirus packaging, MKRN1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to MKRN1/RNF61 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $705.72
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV000773
Gene Name MKRN1
Accession Number NM_013446.4
Gene ID 23608
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1449 bp
Gene Alias RNF61
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGAGGCTGCAACTCCCGGAACAACAGCCACAACATCAGGAGCAGGAGCGGCAGCGGCGACGGCGGCAGCAGCCTCCCCCACCCCGATCCCCACAGTCACCGCCCCGTCCCTGGGGGCGGGCGGAGGGGGCGGCGGCAGCGACGGCAGCGGCGGCGGCTGGACTAAACAGGTCACCTGCAGGTATTTTATGCATGGGGTTTGTAAGGAAGGAGACAACTGTCGCTACTCGCATGACCTCTCTGACAGTCCGTATAGTGTAGTGTGCAAGTATTTTCAGCGAGGGTACTGTATTTATGGAGACCGCTGCAGATATGAACATAGCAAACCATTGAAACAGGAAGAAGCAACTGCTACAGAGCTAACTACAAAGTCATCCCTTGCTGCTTCCTCAAGTCTCTCATCGATAGTTGGACCACTTGTTGAAATGAATACAGGCGAAGCTGAGTCAAGAAATTCAAACTTTGCAACTGTAGGAGCAGGTTCAGAGGACTGGGTGAATGCTATTGAGTTTGTTCCTGGGCAACCCTACTGTGGCCGTACTGCGCCTTCCTGCACTGAAGCACCCCTGCAGGGCTCAGTGACCAAGGAAGAATCAGAGAAAGAGCAAACCGCCGTGGAGACAAAGAAGCAGCTGTGCCCCTATGCTGCAGTGGGAGAGTGCCGATACGGGGAGAACTGTGTGTATCTCCACGGAGATTCTTGTGACATGTGTGGGCTGCAGGTCCTGCATCCAATGGATGCTGCCCAGAGATCGCAGCATATCAAATCGTGCATTGAGGCCCATGAGAAGGACATGGAGCTCTCATTTGCCGTGCAGCGCAGCAAGGACATGGTGTGTGGGATCTGCATGGAGGTGGTCTATGAGAAAGCCAACCCCAGTGAGCGCCGCTTCGGGATCCTCTCCAACTGCAACCACACCTACTGTCTCAAGTGCATTCGCAAGTGGAGGAGTGCTAAGCAATTTGAGAGCAAGATCATAAAGTCCTGCCCAGAATGCCGGATCACATCTAACTTTGTCATTCCAAGTGAGTACTGGGTGGAGGAGAAAGAAGAGAAGCAGAAACTCATTCTGAAATACAAGGAGGCAATGAGCAACAAGGCGTGCAGGTATTTTGATGAAGGACGTGGGAGCTGCCCATTTGGAGGGAACTGTTTTTACAAGCATGCGTACCCTGATGGCCGTAGAGAGGAGCCACAGAGACAGAAAGTGGGAACATCAAGCAGATACCGGGCCCAACGAAGGAACCACTTCTGGGAACTCATTGAGGAAAGAGAGAACAGCAACCCCTTTGACAACGATGAAGAAGAGGTTGTCACCTTTGAGCTGGGCGAGATGTTGCTTATGCTTTTGGCTGCAGGTGGGGACGACGAACTAACAGACTCTGAAGATGAGTGGGACTTGTTTCATGATGAGCTGGAAGATTTTTATGACTTGGATCTATAG
ORF Protein Sequence MAEAATPGTTATTSGAGAAAATAAAASPTPIPTVTAPSLGAGGGGGGSDGSGGGWTKQVTCRYFMHGVCKEGDNCRYSHDLSDSPYSVVCKYFQRGYCIYGDRCRYEHSKPLKQEEATATELTTKSSLAASSSLSSIVGPLVEMNTGEAESRNSNFATVGAGSEDWVNAIEFVPGQPYCGRTAPSCTEAPLQGSVTKEESEKEQTAVETKKQLCPYAAVGECRYGENCVYLHGDSCDMCGLQVLHPMDAAQRSQHIKSCIEAHEKDMELSFAVQRSKDMVCGICMEVVYEKANPSERRFGILSNCNHTYCLKCIRKWRSAKQFESKIIKSCPECRITSNFVIPSEYWVEEKEEKQKLILKYKEAMSNKACRYFDEGRGSCPFGGNCFYKHAYPDGRREEPQRQKVGTSSRYRAQRRNHFWELIEERENSNPFDNDEEEVVTFELGEMLLMLLAAGGDDELTDSEDEWDLFHDELEDFYDLDL

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T86877-Ab Anti-MKRN1 monoclonal antibody
    Target Antigen GM-Tg-g-T86877-Ag MKRN1 protein
    ORF Viral Vector pGMLV000773 Human MKRN1 Lentivirus plasmid
    ORF Viral Vector pGMPC000782 Human MKRN1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector pGMPC001075 Human MKRN1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV000773 Human MKRN1 Lentivirus particle


    Target information

    Target ID GM-T86877
    Target Name MKRN1
    Gene ID 23608, 54484, 716752, 296988, 101092096, 475528, 514986, 100065893
    Gene Symbol and Synonyms MKRN1,RFP,RNF61
    Uniprot Accession Q9UHC7
    Uniprot Entry Name MKRN1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000133606
    Target Classification Not Available

    This gene encodes a protein that belongs to a novel class of zinc finger proteins. The encoded protein functions as a transcriptional co-regulator, and as an E3 ubiquitin ligase that promotes the ubiquitination and proteasomal degradation of target proteins. The protein encoded by this gene is thought to regulate RNA polymerase II-catalyzed transcription. Substrates for this protein's E3 ubiquitin ligase activity include the capsid protein of the West Nile virus and the catalytic subunit of the telomerase ribonucleoprotein. This protein controls cell cycle arrest and apoptosis by regulating p21, a cell cycle regulator, and the tumor suppressor protein p53. Pseudogenes of this gene are present on chromosomes 1, 3, 9, 12 and 20, and on the X chromosome. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2014]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.