Rat Fgf2/bFGF/ Fgf-2 ORF/cDNA clone-Lentivirus plasmid (NM_019305.2)

Pre-made Rat Fgf2/bFGF/ Fgf-2 Lentiviral expression plasmid for Fgf2 lentivirus packaging, Fgf2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

Target products collectionGo to FGF2/Fgf2/bFGF products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name Plasmid Grade Plasmid quantity
pGMLV000938 Rat Fgf2 Lentivirus plasmid Research Grade 10mg, 50mg, 100mg, 500mg, >1g
GMP-like Grade 10mg, 50mg, 100mg, 500mg, >1g
High Quality (HQ) Grade
Seed 5ug


Product Description

Catalog ID pGMLV000938
Gene Name Fgf2
Accession Number NM_019305.2
Gene ID 54250
Species Rat
Product Type Lentivirus plasmid (overexpression)
Insert Length 465 bp
Gene Alias bFGF, Fgf-2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocinmyocin
Fusion Tag Null
Promoter CMV
Resistance Amplicin
Sequence ATGGCTGCCGGCAGCATCACTTCGCTTCCCGCACTGCCGGAGGACGGCGGCGGCGCCTTCCCACCCGGCCACTTCAAGGATCCCAAGCGGCTCTACTGCAAGAACGGCGGCTTCTTCCTGCGCATCCATCCAGACGGCCGCGTGGACGGCGTCCGGGAGAAGAGCGACCCACACGTCAAACTACAGCTCCAAGCAGAAGAGAGAGGAGTTGTGTCCATCAAGGGAGTGTGTGCGAACCGGTACCTGGCTATGAAGGAAGATGGACGGCTGCTGGCTTCTAAGTGTGTTACAGAAGAGTGTTTCTTCTTTGAACGCCTGGAGTCCAATAACTACAACACTTACCGGTCACGGAAATACTCCAGTTGGTATGTGGCACTGAAACGAACTGGGCAGTATAAACTCGGATCCAAAACGGGGCCTGGACAGAAGGCCATACTGTTTCTTCCAATGTCTGCTAAGAGCTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Biosimilar GMP-Bios-INN-820 Pre-Made Eflimrufusp Alfa Biosimilar, Fusion Protein targeting FGF2 fused with human IGHG1 Fc (Fragment constant): Recombinant therapeutic protein targeting BFGF/FGF-2/FGFB/HBGF-2
    Biosimilar GMP-Bios-INN-969 Pre-Made Recifercept biosimilar, Recombinant Protein: Recombinant therapeutic protein targeting FGF
    Target Antibody GM-Tg-g-T31621-Ab Anti-FGF2/ BFGF/ FGF-2 functional antibody
    Target Antigen GM-Tg-g-T31621-Ag FGF2 protein
    Cytokine cks-Tg-g-GM-T31621 fibroblast growth factor 2 (basic) (FGF2) protein & antibody
    ORF Viral Vector pGMLV000801 Human FGF2 Lentivirus plasmid
    ORF Viral Vector pGMLV000938 Rat Fgf2 Lentivirus plasmid
    ORF Viral Vector pGMAD000136 Human FGF2 Adenovirus plasmid
    ORF Viral Vector pGMAD000296 Rat Fgf2 Adenovirus plasmid
    ORF Viral Vector vGMLV000801 Human FGF2 Lentivirus particle
    ORF Viral Vector vGMLV000938 Rat Fgf2 Lentivirus particle
    ORF Viral Vector vGMAD000136 Human FGF2 Adenovirus particle
    ORF Viral Vector vGMAD000296 Rat Fgf2 Adenovirus particle


    Target information

    Target ID GM-T31621
    Target Name FGF2
    Gene ID 2247, 14173, 574136, 54250, 100135772, 403857, 281161, 100033955
    Gene Symbol and Synonyms BFGF,FGF-2,FGF2,Fgf2a,FGFB,HBGF-2
    Uniprot Accession P09038
    Uniprot Entry Name FGF2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target
    Disease Breast Cancer
    Gene Ensembl ENSG00000138685
    Target Classification Checkpoint-Immuno Oncology

    The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members bind heparin and possess broad mitogenic and angiogenic activities. This protein has been implicated in diverse biological processes, such as limb and nervous system development, wound healing, and tumor growth. The mRNA for this gene contains multiple polyadenylation sites, and is alternatively translated from non-AUG (CUG) and AUG initiation codons, resulting in five different isoforms with distinct properties. The CUG-initiated isoforms are localized in the nucleus and are responsible for the intracrine effect, whereas, the AUG-initiated form is mostly cytosolic and is responsible for the paracrine and autocrine effects of this FGF. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.