Rat Fgf2/bFGF/ Fgf-2 ORF/cDNA clone-Lentivirus particle (NM_019305.2)
Pre-made Rat Fgf2/bFGF/ Fgf-2 Lentiviral expression plasmid for Fgf2 lentivirus packaging, Fgf2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to FGF2/Fgf2/bFGF products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLV000938 | Rat Fgf2 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLV000938 |
Gene Name | Fgf2 |
Accession Number | NM_019305.2 |
Gene ID | 54250 |
Species | Rat |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 465 bp |
Gene Alias | bFGF, Fgf-2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocinmyocin |
Fusion Tag | Null |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTGCCGGCAGCATCACTTCGCTTCCCGCACTGCCGGAGGACGGCGGCGGCGCCTTCCCACCCGGCCACTTCAAGGATCCCAAGCGGCTCTACTGCAAGAACGGCGGCTTCTTCCTGCGCATCCATCCAGACGGCCGCGTGGACGGCGTCCGGGAGAAGAGCGACCCACACGTCAAACTACAGCTCCAAGCAGAAGAGAGAGGAGTTGTGTCCATCAAGGGAGTGTGTGCGAACCGGTACCTGGCTATGAAGGAAGATGGACGGCTGCTGGCTTCTAAGTGTGTTACAGAAGAGTGTTTCTTCTTTGAACGCCTGGAGTCCAATAACTACAACACTTACCGGTCACGGAAATACTCCAGTTGGTATGTGGCACTGAAACGAACTGGGCAGTATAAACTCGGATCCAAAACGGGGCCTGGACAGAAGGCCATACTGTTTCTTCCAATGTCTGCTAAGAGCTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Target information
Target ID | GM-T31621 |
Target Name | FGF2 |
Gene ID | 2247, 14173, 574136, 54250, 100135772, 403857, 281161, 100033955 |
Gene Symbol and Synonyms | BFGF,FGF-2,FGF2,Fgf2a,FGFB,HBGF-2 |
Uniprot Accession | P09038 |
Uniprot Entry Name | FGF2_HUMAN |
Protein Sub-location | Secreted Protein/Potential Cytokines |
Category | Therapeutics Target, Immuno-oncology Target, INN Index, Cytokine Target |
Disease | Breast Cancer |
Gene Ensembl | ENSG00000138685 |
Target Classification | Checkpoint-Immuno Oncology |
The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members bind heparin and possess broad mitogenic and angiogenic activities. This protein has been implicated in diverse biological processes, such as limb and nervous system development, wound healing, and tumor growth. The mRNA for this gene contains multiple polyadenylation sites, and is alternatively translated from non-AUG (CUG) and AUG initiation codons, resulting in five different isoforms with distinct properties. The CUG-initiated isoforms are localized in the nucleus and are responsible for the intracrine effect, whereas, the AUG-initiated form is mostly cytosolic and is responsible for the paracrine and autocrine effects of this FGF. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.