Human JCHAIN/IGCJ/IGJ ORF/cDNA clone-Lentivirus plasmid (NM_144646.4)
Cat. No.: pGMLV001012
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human JCHAIN/IGCJ/IGJ Lentiviral expression plasmid for JCHAIN lentivirus packaging, JCHAIN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
JCHAIN/IGCJ products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV001012 |
| Gene Name | JCHAIN |
| Accession Number | NM_144646.4 |
| Gene ID | 3512 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 480 bp |
| Gene Alias | IGCJ,IGJ,JCH |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | HA (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGAAGAACCATTTGCTTTTCTGGGGAGTCCTGGCGGTTTTTATTAAGGCTGTTCATGTGAAAGCCCAAGAAGATGAAAGGATTGTTCTTGTTGACAACAAATGTAAGTGTGCCCGGATTACTTCCAGGATCATCCGTTCTTCCGAAGATCCTAATGAGGACATTGTGGAGAGAAACATCCGAATTATTGTTCCTCTGAACAACAGGGAGAATATCTCTGATCCCACCTCACCATTGAGAACCAGATTTGTGTACCATTTGTCTGACCTCTGTAAAAAATGTGATCCTACAGAAGTGGAGCTGGATAATCAGATAGTTACTGCTACCCAGAGCAATATCTGTGATGAAGACAGTGCTACAGAGACCTGCTACACTTATGACAGAAACAAGTGCTACACAGCTGTGGTCCCACTCGTATATGGTGGTGAGACCAAAATGGTGGAAACAGCCTTAACCCCAGATGCCTGCTATCCTGACTAA |
| ORF Protein Sequence | MKNHLLFWGVLAVFIKAVHVKAQEDERIVLVDNKCKCARITSRIIRSSEDPNEDIVERNIRIIVPLNNRENISDPTSPLRTRFVYHLSDLCKKCDPTEVELDNQIVTATQSNICDEDSATETCYTYDRNKCYTAVVPLVYGGETKMVETALTPDACYPD |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE1043-Ab | Anti-IGJ/ JCHAIN/ IGCJ functional antibody |
| Target Antigen | GM-Tg-g-SE1043-Ag | JCHAIN protein |
| ORF Viral Vector | pGMLV001012 | Human JCHAIN Lentivirus plasmid |
| ORF Viral Vector | vGMLV001012 | Human JCHAIN Lentivirus particle |
Target information
| Target ID | GM-SE1043 |
| Target Name | JCHAIN |
| Gene ID | 3512, 16069, 706650, 360922, 101085285, 475166, 280821, 100629603 |
| Gene Symbol and Synonyms | 9530090F24Rik,IGCJ,IGJ,JCH,JCHAIN |
| Uniprot Accession | P01591 |
| Uniprot Entry Name | IGJ_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000132465 |
| Target Classification | Not Available |
Enables IgA binding activity and protein homodimerization activity. Contributes to several functions, including immunoglobulin receptor binding activity; peptidoglycan binding activity; and phosphatidylcholine binding activity. Involved in several processes, including defense response to other organism; glomerular filtration; and positive regulation of respiratory burst. Located in extracellular space. Part of monomeric IgA immunoglobulin complex; pentameric IgM immunoglobulin complex; and secretory dimeric IgA immunoglobulin complex. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


