Human JCHAIN/IGCJ/IGJ ORF/cDNA clone-Lentivirus plasmid (NM_144646.4)

Cat. No.: pGMLV001012
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human JCHAIN/IGCJ/IGJ Lentiviral expression plasmid for JCHAIN lentivirus packaging, JCHAIN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to JCHAIN/IGCJ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $450
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV001012
Gene Name JCHAIN
Accession Number NM_144646.4
Gene ID 3512
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 480 bp
Gene Alias IGCJ,IGJ,JCH
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag HA (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGAACCATTTGCTTTTCTGGGGAGTCCTGGCGGTTTTTATTAAGGCTGTTCATGTGAAAGCCCAAGAAGATGAAAGGATTGTTCTTGTTGACAACAAATGTAAGTGTGCCCGGATTACTTCCAGGATCATCCGTTCTTCCGAAGATCCTAATGAGGACATTGTGGAGAGAAACATCCGAATTATTGTTCCTCTGAACAACAGGGAGAATATCTCTGATCCCACCTCACCATTGAGAACCAGATTTGTGTACCATTTGTCTGACCTCTGTAAAAAATGTGATCCTACAGAAGTGGAGCTGGATAATCAGATAGTTACTGCTACCCAGAGCAATATCTGTGATGAAGACAGTGCTACAGAGACCTGCTACACTTATGACAGAAACAAGTGCTACACAGCTGTGGTCCCACTCGTATATGGTGGTGAGACCAAAATGGTGGAAACAGCCTTAACCCCAGATGCCTGCTATCCTGACTAA
ORF Protein Sequence MKNHLLFWGVLAVFIKAVHVKAQEDERIVLVDNKCKCARITSRIIRSSEDPNEDIVERNIRIIVPLNNRENISDPTSPLRTRFVYHLSDLCKKCDPTEVELDNQIVTATQSNICDEDSATETCYTYDRNKCYTAVVPLVYGGETKMVETALTPDACYPD

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1043-Ab Anti-IGJ/ JCHAIN/ IGCJ functional antibody
    Target Antigen GM-Tg-g-SE1043-Ag JCHAIN protein
    ORF Viral Vector pGMLV001012 Human JCHAIN Lentivirus plasmid
    ORF Viral Vector vGMLV001012 Human JCHAIN Lentivirus particle


    Target information

    Target ID GM-SE1043
    Target Name JCHAIN
    Gene ID 3512, 16069, 706650, 360922, 101085285, 475166, 280821, 100629603
    Gene Symbol and Synonyms 9530090F24Rik,IGCJ,IGJ,JCH,JCHAIN
    Uniprot Accession P01591
    Uniprot Entry Name IGJ_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000132465
    Target Classification Not Available

    Enables IgA binding activity and protein homodimerization activity. Contributes to several functions, including immunoglobulin receptor binding activity; peptidoglycan binding activity; and phosphatidylcholine binding activity. Involved in several processes, including defense response to other organism; glomerular filtration; and positive regulation of respiratory burst. Located in extracellular space. Part of monomeric IgA immunoglobulin complex; pentameric IgM immunoglobulin complex; and secretory dimeric IgA immunoglobulin complex. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.