Human FAM210B/5A3/C20orf108 ORF/cDNA clone-Lentivirus plasmid (NM_080821.3)

Cat. No.: pGMLV001676
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human FAM210B/5A3/C20orf108 Lentiviral expression plasmid for FAM210B lentivirus packaging, FAM210B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to FAM210B/5A3 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $444.75
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV001676
Gene Name FAM210B
Accession Number NM_080821.3
Gene ID 116151
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 579 bp
Gene Alias 5A3,C20orf108,dJ1167H4.1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCCGGGTTGCTGGCGTTGCTGGGTCCGGCAGGCAGGGTGGGCGCCCGGGTCCGGCCTCGCGCCACCTGGCTCCTGGGCGCCACCGCCCCCTGCGCCCCGCCGCCCCTGGCCCTGGCCCTGCTCCCGCCCAGGCTAGACGCCCGGCTGCTCCGCACGGCGCGCGGGGACTGCCGCGGCCACCAGGACCCCAGCCAGGCCACGGGGACAACAGGCAGCAGCGTCAGCTGCACAGAGGAGAAAAAGCAAAGCAAGTCACAGCAACTGAAAAAGATTTTTCAAGAGTATGGCACTGTTGGCGTGTCATTGCACATTGGAATCTCATTAATTTCCTTGGGCATATTTTACATGGTTGTGTCAAGTGGTGTGGACATGCCTGCAATCCTGCTGAAACTCGGATTTAAAGAGTCCCTGGTACAGTCAAAAATGGCAGCAGGCACAAGTACCTTCGTGGTGGCCTATGCAATCCACAAGCTGTTTGCGCCAGTGAGAATCAGCATTACGCTAGTCTCTGTGCCCTTGATTGTCAGATATTTTCGAAAAGTGGGATTTTTTAAACCTCCAGCTGCAAAACCTTAA
ORF Protein Sequence MAGLLALLGPAGRVGARVRPRATWLLGATAPCAPPPLALALLPPRLDARLLRTARGDCRGHQDPSQATGTTGSSVSCTEEKKQSKSQQLKKIFQEYGTVGVSLHIGISLISLGIFYMVVSSGVDMPAILLKLGFKESLVQSKMAAGTSTFVVAYAIHKLFAPVRISITLVSVPLIVRYFRKVGFFKPPAAKP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0819-Ab Anti-FAM210B monoclonal antibody
    Target Antigen GM-Tg-g-IP0819-Ag FAM210B protein
    ORF Viral Vector pGMLV001676 Human FAM210B Lentivirus plasmid
    ORF Viral Vector vGMLV001676 Human FAM210B Lentivirus particle


    Target information

    Target ID GM-IP0819
    Target Name FAM210B
    Gene ID 116151, 67017, 698314, 296408, 101095163, 485939, 516545, 100054563
    Gene Symbol and Synonyms 2010011I20Rik,5A3,C13H20orf108,C20orf108,C24H20orf108,dJ1167H4.1,FAM210B,RGD1311378
    Uniprot Accession Q96KR6
    Uniprot Entry Name F210B_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000124098
    Target Classification Not Available

    Involved in cellular response to estradiol stimulus and positive regulation of erythrocyte differentiation. Located in mitochondrial outer membrane. Is intrinsic component of membrane. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.