Human SLAMF8/BLAME/CD353 ORF/cDNA clone-Lentivirus plasmid (NM_020125.3)

Cat. No.: pGMLV001989
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human SLAMF8/BLAME/CD353 Lentiviral expression plasmid for SLAMF8 lentivirus packaging, SLAMF8 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to SLAMF8/BLAME products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $514.5
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV001989
Gene Name SLAMF8
Accession Number NM_020125.3
Gene ID 56833
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 858 bp
Gene Alias BLAME,CD353,SBBI42
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTCATGAGGCCCCTGTGGAGTCTGCTTCTCTGGGAAGCCCTACTTCCCATTACAGTTACTGGTGCCCAAGTGCTGAGCAAAGTCGGGGGCTCGGTGCTGCTGGTGGCAGCGCGTCCCCCTGGCTTCCAAGTCCGTGAGGCTATCTGGCGATCTCTCTGGCCTTCAGAAGAGCTCCTGGCCACGTTTTTCCGAGGCTCCCTGGAGACTCTGTACCATTCCCGCTTCCTGGGCCGAGCCCAGCTACACAGCAACCTCAGCCTGGAGCTCGGGCCGCTGGAGTCTGGAGACAGCGGCAACTTCTCCGTGTTGATGGTGGACACAAGGGGCCAGCCCTGGACCCAGACCCTCCAGCTCAAGGTGTACGATGCAGTGCCCAGGCCCGTGGTACAAGTGTTCATTGCTGTAGAAAGGGATGCTCAGCCCTCCAAGACCTGCCAGGTTTTCTTGTCCTGTTGGGCCCCCAACATCAGCGAAATAACCTATAGCTGGCGACGGGAGACAACCATGGACTTTGGTATGGAACCACACAGCCTCTTCACAGACGGACAGGTGCTGAGCATTTCCCTGGGACCAGGAGACAGAGATGTGGCCTATTCCTGCATTGTCTCCAACCCTGTCAGCTGGGACTTGGCCACAGTCACGCCCTGGGATAGCTGTCATCATGAGGCAGCACCAGGGAAGGCCTCCTACAAAGATGTGCTGCTGGTGGTGGTGCCTGTCTCGCTGCTCCTGATGCTGGTTACTCTCTTCTCTGCCTGGCACTGGTGCCCCTGCTCAGGGAAAAAGAAAAAGGATGTCCATGCTGACAGAGTGGGTCCAGAGACAGAGAACCCCCTTGTGCAGGATCTGCCATAA
ORF Protein Sequence MVMRPLWSLLLWEALLPITVTGAQVLSKVGGSVLLVAARPPGFQVREAIWRSLWPSEELLATFFRGSLETLYHSRFLGRAQLHSNLSLELGPLESGDSGNFSVLMVDTRGQPWTQTLQLKVYDAVPRPVVQVFIAVERDAQPSKTCQVFLSCWAPNISEITYSWRRETTMDFGMEPHSLFTDGQVLSISLGPGDRDVAYSCIVSNPVSWDLATVTPWDSCHHEAAPGKASYKDVLLVVVPVSLLLMLVTLFSAWHWCPCSGKKKKDVHADRVGPETENPLVQDLP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP1641-Ab Anti-SLAMF8 monoclonal antibody
    Target Antigen GM-Tg-g-IP1641-Ag SLAMF8 protein
    ORF Viral Vector pGMLV001989 Human SLAMF8 Lentivirus plasmid
    ORF Viral Vector vGMLV001989 Human SLAMF8 Lentivirus particle


    Target information

    Target ID GM-IP1641
    Target Name SLAMF8
    Gene ID 56833, 74748, 719494, 289237, 101092332, 488631, 514609, 100057842
    Gene Symbol and Synonyms 5830408F06Rik,BLAME,CD353,SBBI42,SLAMF8
    Uniprot Accession Q9P0V8
    Uniprot Entry Name SLAF8_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Ovary Cancer
    Gene Ensembl ENSG00000158714
    Target Classification Not Available

    This gene encodes a member of the CD2 family of cell surface proteins involved in lymphocyte activation. These proteins are characterized by Ig domains. This protein is expressed in lymphoid tissues, and studies of a similar protein in mouse suggest that it may function during B cell lineage commitment. The gene is found in a region of chromosome 1 containing many CD2 genes. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.