Human B4GALT3/beta4Gal-T3 ORF/cDNA clone-Lentivirus plasmid (NM_003779.4)
Cat. No.: pGMLV002091
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days
Pre-made Human B4GALT3/beta4Gal-T3 Lentiviral expression plasmid for B4GALT3 lentivirus packaging, B4GALT3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.
Go to
B4GALT3/beta4Gal-T3 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product Description
| Catalog ID | pGMLV002091 |
| Gene Name | B4GALT3 |
| Accession Number | NM_003779.4 |
| Gene ID | 8703 |
| Species | Human |
| Product Type | Lentivirus plasmid (overexpression) |
| Insert Length | 1182 bp |
| Gene Alias | beta4Gal-T3 |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGTTGCGGAGGCTGCTGGAGCGGCCTTGCACGCTGGCCCTGCTTGTGGGCTCCCAGCTGGCTGTCATGATGTACCTGTCACTGGGGGGCTTCCGAAGTCTCAGTGCCCTATTTGGCCGAGATCAGGGACCGACATTTGACTATTCTCACCCTCGTGATGTCTACAGTAACCTCAGTCACCTGCCTGGGGCCCCAGGGGGTCCTCCAGCTCCTCAAGGTCTGCCCTACTGTCCAGAACGATCTCCTCTCTTAGTGGGTCCTGTGTCGGTGTCCTTTAGCCCAGTGCCATCACTGGCAGAGATTGTGGAGCGGAATCCCCGGGTAGAACCAGGGGGCCGGTACCGCCCTGCAGGTTGTGAGCCCCGCTCCCGAACAGCCATCATTGTGCCTCATCGTGCCCGGGAGCACCACCTGCGCCTGCTGCTCTACCACCTGCACCCCTTCTTGCAGCGCCAGCAGCTTGCTTATGGCATCTATGTCATCCACCAGGCTGGAAATGGAACATTTAACAGGGCAAAACTGTTGAACGTTGGGGTGCGAGAGGCCCTGCGTGATGAAGAGTGGGACTGCCTGTTCTTGCACGATGTGGACCTCTTGCCAGAAAATGACCACAATCTGTATGTGTGTGACCCCCGGGGACCCCGCCATGTTGCCGTTGCTATGAACAAGTTTGGATACAGCCTCCCGTACCCCCAGTACTTCGGAGGAGTCTCAGCACTTACTCCTGACCAGTACCTGAAGATGAATGGCTTCCCCAATGAATACTGGGGCTGGGGTGGTGAGGATGACGACATTGCTACCAGGGTGCGCCTGGCTGGGATGAAGATCTCTCGGCCCCCCACATCTGTAGGACACTATAAGATGGTGAAGCACCGAGGAGATAAGGGCAATGAGGAAAATCCCCACAGATTTGACCTCCTGGTCCGTACCCAGAATTCCTGGACGCAAGATGGGATGAACTCACTGACATACCAGTTGCTGGCTCGAGAGCTGGGGCCTCTTTATACCAACATCACAGCAGACATTGGGACTGACCCTCGGGGTCCTCGGGCTCCTTCTGGGCCACGTTACCCACCTGGTTCCTCCCAAGCCTTCCGTCAAGAGATGCTGCAACGCCGGCCCCCAGCCAGGCCTGGGCCTCTATCTACTGCCAACCACACAGCCCTCCGAGGTTCACACTGA |
| ORF Protein Sequence | MLRRLLERPCTLALLVGSQLAVMMYLSLGGFRSLSALFGRDQGPTFDYSHPRDVYSNLSHLPGAPGGPPAPQGLPYCPERSPLLVGPVSVSFSPVPSLAEIVERNPRVEPGGRYRPAGCEPRSRTAIIVPHRAREHHLRLLLYHLHPFLQRQQLAYGIYVIHQAGNGTFNRAKLLNVGVREALRDEEWDCLFLHDVDLLPENDHNLYVCDPRGPRHVAVAMNKFGYSLPYPQYFGGVSALTPDQYLKMNGFPNEYWGWGGEDDDIATRVRLAGMKISRPPTSVGHYKMVKHRGDKGNEENPHRFDLLVRTQNSWTQDGMNSLTYQLLARELGPLYTNITADIGTDPRGPRAPSGPRYPPGSSQAFRQEMLQRRPPARPGPLSTANHTALRGSH |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-IP0411-Ab | Anti-B4GALT3 monoclonal antibody |
| Target Antigen | GM-Tg-g-IP0411-Ag | B4GALT3 protein |
| ORF Viral Vector | pGMLV002091 | Human B4GALT3 Lentivirus plasmid |
| ORF Viral Vector | vGMLV002091 | Human B4GALT3 Lentivirus particle |
Target information
| Target ID | GM-IP0411 |
| Target Name | B4GALT3 |
| Gene ID | 8703, 57370, 719920, 494342, 101089738, 488650, 515771, 100066144 |
| Gene Symbol and Synonyms | 9530061M23Rik,B4GALT3,beta4Gal-T3,ESTM26,ESTM6 |
| Uniprot Accession | O60512 |
| Uniprot Entry Name | B4GT3_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Not Available |
| Disease | Not Available |
| Gene Ensembl | ENSG00000158850 |
| Target Classification | Not Available |
This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


