Human TMEM192 ORF/cDNA clone-Lentivirus plasmid (NM_001100389)

Cat. No.: pGMLV002263
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human TMEM192/ Lentiviral expression plasmid for TMEM192 lentivirus packaging, TMEM192 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to TMEM192/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $504
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002263
Gene Name TMEM192
Accession Number NM_001100389
Gene ID 201931
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 816 bp
Gene Alias
Fluorescent Reporter Null
Mammalian Cell Selection Blasticidin (BSD)
Fusion Tag HA (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGCGGCGGGGGGCAGGATGGAGGACGGTTCCTTGGATATCACCCAGAGTATTGAAGACGACCCACTTCTGGATGCCCAGCTTCTCCCACACCACTCATTACAAGCTCACTTTAGACCCCGATTCCATCCTCTTCCTACAGTCATCATAGTGAATCTTCTGTGGTTTATTCATCTCGTGTTTGTTGTTTTAGCATTTTTAACAGGTGTGCTTTGTTCTTATCCTAATCCAAATGAGGACAAGTGCCCAGGAAATTACACAAACCCATTGAAAGTTCAGACGGTTATAATCCTTGGGAAAGTTATTTTGTGGATTCTCCATTTACTCCTTGAATGCTACATCCAGTATCACCACAGCAAAATCAGAAACCGAGGCTATAACTTGATCTACCGATCAACAAGGCATCTCAAGAGACTTGCGTTGATGATACAGTCCTCTGGCAACACAGTGCTTCTCCTCATACTGTGCATGCAGCACTCCTTCCCAGAGCCTGGCAGATTGTATCTTGACCTCATTCTGGCCATCTTGGCACTGGAACTCATCTGTTCCCTGATATGTCTCCTCATTTACACAGTGAAAATCCGGAGATTTAATAAAGCTAAACCAGAGCCTGATATACTTGAAGAAGAAAAAATCTATGCTTACCCCAGCAATATTACCTCGGAGACTGGATTCAGAACTATTTCAAGCCTAGAAGAAATTGTTGAAAAGCAAGGAGACACCATTGAATACCTGAAGCGACACAATGCGCTGCTGAGTAAGCGATTGTTGGCTCTCACTTCCTCAGACCTGGGCTGTCAGCCAAGTAGAACGTGA
ORF Protein Sequence MAAGGRMEDGSLDITQSIEDDPLLDAQLLPHHSLQAHFRPRFHPLPTVIIVNLLWFIHLVFVVLAFLTGVLCSYPNPNEDKCPGNYTNPLKVQTVIILGKVILWILHLLLECYIQYHHSKIRNRGYNLIYRSTRHLKRLALMIQSSGNTVLLLILCMQHSFPEPGRLYLDLILAILALELICSLICLLIYTVKIRRFNKAKPEPDILEEEKIYAYPSNITSETGFRTISSLEEIVEKQGDTIEYLKRHNALLSKRLLALTSSDLGCQPSRT

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP2033-Ab Anti-TMEM192 monoclonal antibody
    Target Antigen GM-Tg-g-IP2033-Ag TMEM192 protein
    ORF Viral Vector pGMLV000908 Human TMEM192 Lentivirus plasmid
    ORF Viral Vector pGMLV002037 Human TMEM192 Lentivirus plasmid
    ORF Viral Vector pGMLV002263 Human TMEM192 Lentivirus plasmid
    ORF Viral Vector vGMLV000908 Human TMEM192 Lentivirus particle
    ORF Viral Vector vGMLV002037 Human TMEM192 Lentivirus particle
    ORF Viral Vector vGMLV002263 Human TMEM192 Lentivirus particle


    Target information

    Target ID GM-IP2033
    Target Name TMEM192
    Gene ID 201931, 73067, 708459, 361137, 101081976, 475489, 613396, 100068165
    Gene Symbol and Synonyms 3110005G23Rik,RGD1309341,TMEM192
    Uniprot Accession Q8IY95
    Uniprot Entry Name TM192_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000170088
    Target Classification Not Available

    Enables protein homodimerization activity. Located in several cellular components, including late endosome; lysosomal membrane; and perinuclear region of cytoplasm. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.