Human ELK3/ERP/NET ORF/cDNA clone-Lentivirus plasmid (NM_001413760.1)

Cat. No.: pGMLV002565
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ELK3/ERP/NET Lentiviral expression plasmid for ELK3 lentivirus packaging, ELK3 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to ELK3/ERP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $642.72
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002565
Gene Name ELK3
Accession Number NM_001413760.1
Gene ID 2004
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1224 bp
Gene Alias ERP,NET,SAP-2,SAP2
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGAGAGTGCAATCACGCTGTGGCAGTTCCTGTTGCAGTTGCTGCTGGATCAGAAACATGAGCATTTGATCTGCTGGACCTCGAACGATGGTGAATTCAAGCTCCTCAAAGCAGAAGAAGTGGCCAAGCTGTGGGGACTCCGAAAAAACAAAACAAATATGAACTATGATAAGCTGAGCAGAGCCCTGCGATACTATTATGACAAGAACATCATCAAGAAGGTGATCGGGCAGAAGTTTGTGTACAAGTTTGTCTCTTTCCCGGAGATCCTGAAGATGGATCCTCACGCGGTGGAGATCAGCCGGGAGAGCCTTCTGCTGCAGGACAGCGACTGCAAGGCGTCTCCGGAGGGCCGCGAGGCCCACAAACACGGCCTGGCCGCCCTCAGAAGCACGAGCCGCAACGAATACATCCACTCAGGCCTGTACTCGTCCTTCACCATTAATTCCCTGCAGAACCCACCAGACGCCTTCAAGGCCATCAAGACGGAGAAGCTGGAGGAGCCGCCCGAAGACAGCCCCCCCGTGGAAGAAGTCAGGACTGTGATCAGGTTTGTGACCAATAAAACCGACAAGCACGTCACCAGGCCGGTGGTGTCCCTGCCTTCCACGTCAGAGGCTGCGGCGGCGTCCGCCTTCCTGGCCTCGTCCGTCTCGGCCAAGATCTCCTCTTTAATGTTGCCAAACGCTGCCAGTATTTCATCCGCCTCACCCTTCTCATCTCGGTCCCCGTCCCTGTCCCCCAACTCACCCCTCCCTTCTGAACACAGAAGCCTCTTCCTGGAGGCCGCCTGCCATGACTCCGATTCCCTGGAGCCCTTGAACCTGTCATCGGGCTCCAAGACCAAGTCTCCATCTCTTCCCCCAAAGGCCAAAAAACCCAAAGGCTTGGAAATCTCAGCGCCCCCGCTGGTGCTCTCCGGCACCGACATCGGCTCCATCGCCCTCAACAGCCCAGCCCTCCCCTCGGGATCCCTCACCCCAGCCTTCTTCACCGCACAGACACCAAATGGATTGCTTCTGACTCCGAGTCCACTGCTCTCCAGCATACATTTCTGGAGCAGCCTTAGTCCAGTTGCTCCGCTGAGTCCTGCCAGGCTGCAAGGGCCAAGCACGCTGTTCCAGTTCCCCACACTGCTTAATGGCCACATGCCAGTGCCAATCCCCAGTCTGGACAGAGCTGCTTCTCCAGTACTGCTTTCTTCAAACTCTCAGAAATCCTGA
ORF Protein Sequence MESAITLWQFLLQLLLDQKHEHLICWTSNDGEFKLLKAEEVAKLWGLRKNKTNMNYDKLSRALRYYYDKNIIKKVIGQKFVYKFVSFPEILKMDPHAVEISRESLLLQDSDCKASPEGREAHKHGLAALRSTSRNEYIHSGLYSSFTINSLQNPPDAFKAIKTEKLEEPPEDSPPVEEVRTVIRFVTNKTDKHVTRPVVSLPSTSEAAAASAFLASSVSAKISSLMLPNAASISSASPFSSRSPSLSPNSPLPSEHRSLFLEAACHDSDSLEPLNLSSGSKTKSPSLPPKAKKPKGLEISAPPLVLSGTDIGSIALNSPALPSGSLTPAFFTAQTPNGLLLTPSPLLSSIHFWSSLSPVAPLSPARLQGPSTLFQFPTLLNGHMPVPIPSLDRAASPVLLSSNSQKS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T91906-Ab Anti-ELK3 monoclonal antibody
    Target Antigen GM-Tg-g-T91906-Ag ELK3 protein
    ORF Viral Vector pGMLV002565 Human ELK3 Lentivirus plasmid
    ORF Viral Vector vGMLV002565 Human ELK3 Lentivirus particle


    Target information

    Target ID GM-T91906
    Target Name ELK3
    Gene ID 2004, 13713, 713100, 362871, 101084208, 482613, 541125, 100052318
    Gene Symbol and Synonyms D430049E23Rik,ELK3,ERP,Etrp,NET,SAP-2,SAP2
    Uniprot Accession P41970
    Uniprot Entry Name ELK3_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000111145
    Target Classification Not Available

    This gene encodes a member of the ETS-domain transcription factor family and the ternary complex factor (TCF) subfamily. Proteins in this subfamily regulate transcription when recruited by serum response factor to bind to serum response elements. This protein is activated by signal-induced phosphorylation; studies in rodents suggest that it is a transcriptional inhibitor in the absence of Ras, but activates transcription when Ras is present. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2015]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.