Human BCAT1/BCATC/BCT1 ORF/cDNA clone-Lentivirus plasmid (NM_005504.7)

Cat. No.: pGMLV002643
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human BCAT1/BCATC/BCT1 Lentiviral expression plasmid for BCAT1 lentivirus packaging, BCAT1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to BCAT1/BCATC products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $625.08
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002643
Gene Name BCAT1
Accession Number NM_005504.7
Gene ID 586
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1161 bp
Gene Alias BCATC,BCT1,ECA39,MECA39,PNAS121,PP18
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGAAGGATTGCAGTAACGGATGCTCCGCAGAGTGTACCGGAGAAGGAGGATCAAAAGAGGTGGTGGGGACTTTTAAGGCTAAAGACCTAATAGTCACACCAGCTACCATTTTAAAGGAAAAACCAGACCCCAATAATCTGGTTTTTGGAACTGTGTTCACGGATCATATGCTGACGGTGGAGTGGTCCTCAGAGTTTGGATGGGAGAAACCTCATATCAAGCCTCTTCAGAACCTGTCATTGCACCCTGGCTCATCAGCTTTGCACTATGCAGTGGAATTATTTGAAGGATTGAAGGCATTTCGAGGAGTAGATAATAAAATTCGACTGTTTCAGCCAAACCTCAACATGGATAGAATGTATCGCTCTGCTGTGAGGGCAACTCTGCCGGTATTTGACAAAGAAGAGCTCTTAGAGTGTATTCAACAGCTTGTGAAATTGGATCAAGAATGGGTCCCATATTCAACATCTGCTAGTCTGTATATTCGTCCTACATTCATTGGAACTGAGCCTTCTCTTGGAGTCAAGAAGCCTACCAAAGCCCTGCTCTTTGTACTCTTGAGCCCAGTGGGACCTTATTTTTCAAGTGGAACCTTTAATCCAGTGTCCCTGTGGGCCAATCCCAAGTATGTAAGAGCCTGGAAAGGTGGAACTGGGGACTGCAAGATGGGAGGGAATTACGGCTCATCTCTTTTTGCCCAATGTGAAGCAGTAGATAATGGGTGTCAGCAGGTCCTGTGGCTCTATGGAGAGGACCATCAGATCACTGAAGTGGGAACTATGAATCTTTTTCTTTACTGGATAAATGAAGATGGAGAAGAAGAACTGGCAACTCCTCCACTAGATGGCATCATTCTTCCAGGAGTGACAAGGCGGTGCATTCTGGACCTGGCACATCAGTGGGGTGAATTTAAGGTGTCAGAGAGATACCTCACCATGGATGACTTGACAACAGCCCTGGAGGGGAACAGAGTGAGAGAGATGTTTGGCTCTGGTACAGCCTGTGTTGTTTGCCCAGTTTCTGATATACTGTACAAAGGCGAGACAATACACATTCCAACTATGGAGAATGGTCCTAAGCTGGCAAGCCGCATCTTGAGCAAATTAACTGATATCCAGTATGGAAGAGAAGAGAGCGACTGGACAATTGTGCTATCCTGA
ORF Protein Sequence MKDCSNGCSAECTGEGGSKEVVGTFKAKDLIVTPATILKEKPDPNNLVFGTVFTDHMLTVEWSSEFGWEKPHIKPLQNLSLHPGSSALHYAVELFEGLKAFRGVDNKIRLFQPNLNMDRMYRSAVRATLPVFDKEELLECIQQLVKLDQEWVPYSTSASLYIRPTFIGTEPSLGVKKPTKALLFVLLSPVGPYFSSGTFNPVSLWANPKYVRAWKGGTGDCKMGGNYGSSLFAQCEAVDNGCQQVLWLYGEDHQITEVGTMNLFLYWINEDGEEELATPPLDGIILPGVTRRCILDLAHQWGEFKVSERYLTMDDLTTALEGNRVREMFGSGTACVVCPVSDILYKGETIHIPTMENGPKLASRILSKLTDIQYGREESDWTIVLS

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T92557-Ab Anti-BCAT1 monoclonal antibody
    Target Antigen GM-Tg-g-T92557-Ag BCAT1 protein
    ORF Viral Vector pGMLP003112 Human BCAT1 Lentivirus plasmid
    ORF Viral Vector pGMLV002193 Human BCAT1 Lentivirus plasmid
    ORF Viral Vector pGMLV002643 Human BCAT1 Lentivirus plasmid
    ORF Viral Vector vGMLP003112 Human BCAT1 Lentivirus particle
    ORF Viral Vector vGMLV002193 Human BCAT1 Lentivirus particle
    ORF Viral Vector vGMLV002643 Human BCAT1 Lentivirus particle


    Target information

    Target ID GM-T92557
    Target Name BCAT1
    Gene ID 586, 12035, 707321, 29592, 101097404, 486633, 505926, 100068713
    Gene Symbol and Synonyms BCAT1,BCATC,BCT1,ECA39,MECA39,PNAS121,PP18
    Uniprot Accession P54687
    Uniprot Entry Name BCAT1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000060982
    Target Classification Not Available

    This gene encodes the cytosolic form of the enzyme branched-chain amino acid transaminase. This enzyme catalyzes the reversible transamination of branched-chain alpha-keto acids to branched-chain L-amino acids essential for cell growth. Two different clinical disorders have been attributed to a defect of branched-chain amino acid transamination: hypervalinemia and hyperleucine-isoleucinemia. As there is also a gene encoding a mitochondrial form of this enzyme, mutations in either gene may contribute to these disorders. Alternatively spliced transcript variants have been described. [provided by RefSeq, May 2010]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.