Human ARMC10/PNAS-112/PNAS112 ORF/cDNA clone-Lentivirus plasmid (NM_031905.5)

Cat. No.: pGMLV002660
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human ARMC10/PNAS-112/PNAS112 Lentiviral expression plasmid for ARMC10 lentivirus packaging, ARMC10 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.

pdf Datasheet
pdf MSDS
pdf Terms of Use
Target products collection

Go to ARMC10/PNAS-112 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $588.96
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002660
Gene Name ARMC10
Accession Number NM_031905.5
Gene ID 83787
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1032 bp
Gene Alias PNAS-112,PNAS112,PSEC0198,SVH
Fluorescent Reporter Null
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGGTGGCCCCCGGGGCGCGGGCTGGGTGGCGGCGGGCCTGCTGCTCGGCGCGGGCGCCTGCTACTGCATTTACAGGCTGACCCGGGGTCGGCGGCGGGGCGACCGCGAGCTCGGGATACGCTCTTCGAAGTCCGCAGGTGCCCTGGAAGAAGGGACGTCAGAGGGTCAGTTGTGCGGGCGCTCGGCCCGGCCTCAGACGGGAGGTACCTGGGAGTCACAGTGGTCCAAGACCTCGCAGCCTGAAGACTTAACTGATGGTTCATATGATGATGTTCTAAATGCTGAACAACTTCAGAAACTCCTTTACCTGCTGGAGTCAACGGAGGATCCTGTAATTATTGAAAGAGCTTTGATTACTTTGGGTAACAATGCAGCCTTTTCAGTTAACCAAGCTATTATTCGTGAATTGGGTGGTATTCCAATTGTTGCAAACAAAATCAACCATTCCAACCAGAGTATTAAAGAGAAAGCTTTAAATGCACTAAATAACCTGAGTGTGAATGTTGAAAATCAAATCAAGATAAAGATATACATCAGTCAAGTATGTGAGGATGTCTTCTCTGGTCCTCTGAACTCTGCTGTGCAGCTGGCTGGACTGACATTGTTGACAAACATGACTGTTACCAATGACCACCAGCACATGCTTCACAGTTACATTACAGACCTGTTCCAGGTGTTACTTACTGGAAATGGAAACACGAAGGTGCAAGTTTTGAAACTGCTTTTGAATTTGTCTGAAAATCCAGCCATGACAGAAGGACTTCTCCGTGCCCAAGTGGATTCATCATTCCTTTCCCTTTATGACAGCCACGTAGCAAAGGAGATTCTTCTTCGAGTACTTACGCTATTTCAGAATATAAAGAACTGCCTCAAAATAGAAGGCCATTTAGCTGTGCAGCCTACTTTCACTGAAGGTTCATTGTTTTTCCTGTTACATGGAGAAGAATGTGCCCAGAAAATAAGAGCTTTAGTTGATCACCATGATGCAGAGGTGAAGGAAAAGGTTGTAACAATAATACCCAAAATCTGA
ORF Protein Sequence MGGPRGAGWVAAGLLLGAGACYCIYRLTRGRRRGDRELGIRSSKSAGALEEGTSEGQLCGRSARPQTGGTWESQWSKTSQPEDLTDGSYDDVLNAEQLQKLLYLLESTEDPVIIERALITLGNNAAFSVNQAIIRELGGIPIVANKINHSNQSIKEKALNALNNLSVNVENQIKIKIYISQVCEDVFSGPLNSAVQLAGLTLLTNMTVTNDHQHMLHSYITDLFQVLLTGNGNTKVQVLKLLLNLSENPAMTEGLLRAQVDSSFLSLYDSHVAKEILLRVLTLFQNIKNCLKIEGHLAVQPTFTEGSLFFLLHGEECAQKIRALVDHHDAEVKEKVVTIIPKI

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0354-Ab Anti-ARMC10 monoclonal antibody
    Target Antigen GM-Tg-g-IP0354-Ag ARMC10 protein
    ORF Viral Vector pGMLV002660 Human ARMC10 Lentivirus plasmid
    ORF Viral Vector vGMLV002660 Human ARMC10 Lentivirus particle


    Target information

    Target ID GM-IP0354
    Target Name ARMC10
    Gene ID 83787, 67211, 695210, 296758, 101086960, 475899, 100138038, 100058288
    Gene Symbol and Synonyms 2810037C14Rik,ARMC10,PNAS-112,PNAS112,PSEC0198,RGD1305915,SVH
    Uniprot Accession Q8N2F6
    Uniprot Entry Name ARM10_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000170632
    Target Classification Not Available

    This gene encodes a protein that contains an armadillo repeat and transmembrane domain. The encoded protein decreases the transcriptional activity of the tumor suppressor protein p53 through direct interaction with the DNA-binding domain of p53, and may play a role in cell growth and survival. Upregulation of this gene may play a role in hepatocellular carcinoma. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 3. [provided by RefSeq, Sep 2011]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.