Human LGMN/AEP/LGMN1 ORF/cDNA clone-Lentivirus plasmid (NM_005606.7)

Cat. No.: pGMLV002716
Size: 10 µg
Concentration: generally 0.5ug/ul, usually not less than 0.3ug/ul
Leading Time: 3-7 working days

Pre-made Human LGMN/AEP/LGMN1 Lentiviral expression plasmid for LGMN lentivirus packaging, LGMN lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

Our GM-Lentiviral vector is seamlessly integrated with the GM lentivirus packaging system. Discover more about the GM lentivirus packaging system.


Target products collection

Go to LGMN/AEP products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Purchase
Total Price: $664.56
Shipping fee: Limited-time free
For payment issues, contact us.


Product Description

Catalog ID pGMLV002716
Gene Name LGMN
Accession Number NM_005606.7
Gene ID 5641
Species Human
Product Type Lentivirus plasmid (overexpression)
Insert Length 1302 bp
Gene Alias AEP,LGMN1,PRSC1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGTTTGGAAAGTAGCTGTATTCCTCAGTGTGGCCCTGGGCATTGGTGCCGTTCCTATAGATGATCCTGAAGATGGAGGCAAGCACTGGGTGGTGATCGTGGCAGGTTCAAATGGCTGGTATAATTATAGGCACCAGGCAGACGCGTGCCATGCCTACCAGATCATTCACCGCAATGGGATTCCTGACGAACAGATCGTTGTGATGATGTACGATGACATTGCTTACTCTGAAGACAATCCCACTCCAGGAATTGTGATCAACAGGCCCAATGGCACAGATGTCTATCAGGGAGTCCCGAAGGACTACACTGGAGAGGATGTTACCCCACAAAATTTCCTTGCTGTGTTGAGAGGCGATGCAGAAGCAGTGAAGGGCATAGGATCCGGCAAAGTCCTGAAGAGTGGCCCCCAGGATCACGTGTTCATTTACTTCACTGACCATGGATCTACTGGAATACTGGTTTTTCCCAATGAAGATCTTCATGTAAAGGACCTGAATGAGACCATCCATTACATGTACAAACACAAAATGTACCGAAAGATGGTGTTCTACATTGAAGCCTGTGAGTCTGGGTCCATGATGAACCACCTGCCGGATAACATCAATGTTTATGCAACTACTGCTGCCAACCCCAGAGAGTCGTCCTACGCCTGTTACTATGATGAGAAGAGGTCCACGTACCTGGGGGACTGGTACAGCGTCAACTGGATGGAAGATTCGGACGTGGAAGATCTGACTAAAGAGACCCTGCACAAGCAGTACCACCTGGTAAAATCGCACACCAACACCAGCCACGTCATGCAGTATGGAAACAAAACAATCTCCACCATGAAAGTGATGCAGTTTCAGGGTATGAAACGCAAAGCCAGTTCTCCCGTCCCCCTACCTCCAGTCACACACCTTGACCTCACCCCCAGCCCTGATGTGCCTCTCACCATCATGAAAAGGAAACTGATGAACACCAATGATCTGGAGGAGTCCAGGCAGCTCACGGAGGAGATCCAGCGGCATCTGGATGCCAGGCACCTCATTGAGAAGTCAGTGCGTAAGATCGTCTCCTTGCTGGCAGCGTCCGAGGCTGAGGTGGAGCAGCTCCTGTCCGAGAGAGCCCCGCTCACGGGGCACAGCTGCTACCCAGAGGCCCTGCTGCACTTCCGGACCCACTGCTTCAACTGGCACTCCCCCACGTACGAGTATGCGTTGAGACATTTGTACGTGCTGGTCAACCTTTGTGAGAAGCCGTATCCGCTTCACAGGATAAAATTGTCCATGGACCACGTGTGCCTTGGTCACTACTGA
ORF Protein Sequence MVWKVAVFLSVALGIGAVPIDDPEDGGKHWVVIVAGSNGWYNYRHQADACHAYQIIHRNGIPDEQIVVMMYDDIAYSEDNPTPGIVINRPNGTDVYQGVPKDYTGEDVTPQNFLAVLRGDAEAVKGIGSGKVLKSGPQDHVFIYFTDHGSTGILVFPNEDLHVKDLNETIHYMYKHKMYRKMVFYIEACESGSMMNHLPDNINVYATTAANPRESSYACYYDEKRSTYLGDWYSVNWMEDSDVEDLTKETLHKQYHLVKSHTNTSHVMQYGNKTISTMKVMQFQGMKRKASSPVPLPPVTHLDLTPSPDVPLTIMKRKLMNTNDLEESRQLTEEIQRHLDARHLIEKSVRKIVSLLAASEAEVEQLLSERAPLTGHSCYPEALLHFRTHCFNWHSPTYEYALRHLYVLVNLCEKPYPLHRIKLSMDHVCLGHY

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T32973-Ab Anti-LGMN/ AEP1/ PRSC1 functional antibody
    Target Antigen GM-Tg-g-T32973-Ag LGMN protein
    ORF Viral Vector pGMLV002716 Human LGMN Lentivirus plasmid
    ORF Viral Vector pGMPC001088 Human LGMN Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLV002716 Human LGMN Lentivirus particle


    Target information

    Target ID GM-T32973
    Target Name LGMN
    Gene ID 5641, 19141, 703734, 63865, 101098470, 480232, 281281, 100053265
    Gene Symbol and Synonyms AEP,LGMN,LGMN1,PRSC1
    Uniprot Accession Q99538
    Uniprot Entry Name LGMN_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Therapeutics Target
    Disease Lung Cancer
    Gene Ensembl ENSG00000100600
    Target Classification Not Available

    This gene encodes a cysteine protease that has a strict specificity for hydrolysis of asparaginyl bonds. This enzyme may be involved in the processing of bacterial peptides and endogenous proteins for MHC class II presentation in the lysosomal/endosomal systems. Enzyme activation is triggered by acidic pH and appears to be autocatalytic. Protein expression occurs after monocytes differentiate into dendritic cells. A fully mature, active enzyme is produced following lipopolysaccharide expression in mature dendritic cells. Overexpression of this gene may be associated with the majority of solid tumor types. This gene has a pseudogene on chromosome 13. Several alternatively spliced transcript variants have been described, but the biological validity of only two has been determined. These two variants encode the same isoform. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.