Human IL27/IL-27/IL-27A ORF/cDNA clone-Adenovirus particle (NM_145659)
Cat. No.: vGMAP-IL-117
Pre-made Human IL27/IL-27/IL-27A Adenovirus for IL27 overexpression in-vitro and in-vivo. The IL27 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IL27-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
IL27/IL-27 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP-IL-117 | Human IL27 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP-IL-117 |
| Gene Name | IL27 |
| Accession Number | NM_145659 |
| Gene ID | 246778 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 732 bp |
| Gene Alias | IL-27,IL-27A,IL27A,IL27p28,IL30,p28 |
| Fluorescent Reporter | EGFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGGGCCAGACGGCAGGCGACCTTGGCTGGCGGCTCAGCCTGTTGCTGCTTCCCTTGCTCCTGGTTCAAGCTGGTGTCTGGGGATTCCCAAGGCCCCCAGGGAGGCCCCAGCTGAGCCTGCAGGAGCTGCGGAGGGAGTTCACAGTCAGCCTGCATCTCGCCAGGAAGCTGCTCTCCGAGGTTCGGGGCCAGGCCCACCGCTTTGCGGAATCTCACCTGCCAGGAGTGAACCTGTACCTCCTGCCCCTGGGAGAGCAGCTCCCTGATGTTTCCCTGACCTTCCAGGCCTGGCGCCGCCTCTCTGACCCGGAGCGTCTCTGCTTCATCTCCACCACGCTTCAGCCCTTCCATGCCCTGCTGGGAGGGCTGGGGACCCAGGGCCGCTGGACCAACATGGAGAGGATGCAGCTGTGGGCCATGAGGCTGGACCTCCGCGATCTGCAGCGGCACCTCCGCTTCCAGGTGCTGGCTGCAGGATTCAACCTCCCGGAGGAGGAGGAGGAGGAAGAGGAGGAGGAGGAGGAGGAGAGGAAGGGGCTGCTCCCAGGGGCACTGGGCAGCGCCTTACAGGGCCCGGCCCAGGTGTCCTGGCCCCAGCTCCTCTCCACCTACCGCCTGCTGCACTCCTTGGAGCTCGTCTTATCTCGGGCCGTGCGGGAGTTGCTGCTGCTGTCCAAGGCTGGGCACTCAGTCTGGCCCTTGGGGTTCCCAACATTGAGCCCCCAGCCCTGA |
| ORF Protein Sequence | MGQTAGDLGWRLSLLLLPLLLVQAGVWGFPRPPGRPQLSLQELRREFTVSLHLARKLLSEVRGQAHRFAESHLPGVNLYLLPLGEQLPDVSLTFQAWRRLSDPERLCFISTTLQPFHALLGGLGTQGRWTNMERMQLWAMRLDLRDLQRHLRFQVLAAGFNLPEEEEEEEEEEEEERKGLLPGALGSALQGPAQVSWPQLLSTYRLLHSLELVLSRAVRELLLLSKAGHSVWPLGFPTLSPQP |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE1026-Ab | Anti-IL27A/ IL27/ IL-27 functional antibody |
| Target Antigen | GM-Tg-g-SE1026-Ag | IL27 protein |
| ORF Viral Vector | pGMLP002772 | Human IL27 Lentivirus plasmid |
| ORF Viral Vector | pGMLP-IL-034 | Human IL27 Lentivirus plasmid |
| ORF Viral Vector | pGMAP-IL-117 | Human IL27 Adenovirus plasmid |
| ORF Viral Vector | vGMLP002772 | Human IL27 Lentivirus particle |
| ORF Viral Vector | vGMLP-IL-034 | Human IL27 Lentivirus particle |
| ORF Viral Vector | vGMAP-IL-117 | Human IL27 Adenovirus particle |
Target information
| Target ID | GM-SE1026 |
| Target Name | IL27 |
| Gene ID | 246778, 246779, 708678, 365368, 101093822, 607880, 614927, 100066317 |
| Gene Symbol and Synonyms | IL-27,IL-27-A,IL-27A,IL-27alpha,IL-27p28,IL27,IL27-A,IL27A,IL27p28,IL30,p28,RGD1561420 |
| Uniprot Accession | Q8NEV9 |
| Uniprot Entry Name | IL27A_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Not Available |
| Disease | Cancer |
| Gene Ensembl | ENSG00000197272 |
| Target Classification | Tumor-associated antigen (TAA) |
The protein encoded by this gene is one of the subunits of a heterodimeric cytokine complex. This protein is related to interleukin 12A (IL12A). It interacts with Epstein-Barr virus induced gene 3 (EBI3), a protein similar to interleukin 12B (IL12B), and forms a complex that has been shown to drive rapid expansion of naive but not memory CD4(+) T cells. The complex is also found to synergize strongly with interleukin 12 to trigger interferon gamma (IFNG) production of naive CD4(+) T cells. The biological effects of this cytokine are mediated by the class I cytokine receptor (WSX1/TCRR). [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


