Human PRKAA1/AMPK/AMPKa1 ORF/cDNA clone-Adenovirus particle (NM_006251)

Cat. No.: vGMAP-SPh-272

Pre-made Human PRKAA1/AMPK/AMPKa1 Adenovirus for PRKAA1 overexpression in-vitro and in-vivo. The PRKAA1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified PRKAA1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to PRKAA1/AMPK products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP-SPh-272 Human PRKAA1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP-SPh-272
Gene Name PRKAA1
Accession Number NM_006251
Gene ID 5562
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 1680 bp
Gene Alias AMPK,AMPKa1
Fluorescent Reporter EGFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Amplicin
ORF Nucleotide Sequence ATGCGCAGACTCAGTTCCTGGAGAAAGATGGCGACAGCCGAGAAGCAGAAACACGACGGGCGGGTGAAGATCGGCCACTACATTCTGGGTGACACGCTGGGGGTCGGCACCTTCGGCAAAGTGAAGGTTGGCAAACATGAATTGACTGGGCATAAAGTAGCTGTGAAGATACTCAATCGACAGAAGATTCGGAGCCTTGATGTGGTAGGAAAAATCCGCAGAGAAATTCAGAACCTCAAGCTTTTCAGGCATCCTCATATAATTAAACTGTACCAGGTCATCAGTACACCATCTGATATTTTCATGGTGATGGAATATGTCTCAGGAGGAGAGCTATTTGATTATATCTGTAAGAATGGAAGGCTGGATGAAAAAGAAAGTCGGCGTCTGTTCCAACAGATCCTTTCTGGTGTGGATTATTGTCACAGGCATATGGTGGTCCATAGAGATTTGAAACCTGAAAATGTCCTGCTTGATGCACACATGAATGCAAAGATAGCTGATTTTGGTCTTTCAAACATGATGTCAGATGGTGAATTTTTAAGAACAAGTTGTGGCTCACCCAACTATGCTGCACCAGAAGTAATTTCAGGAAGATTGTATGCAGGCCCAGAGGTAGATATATGGAGCAGTGGGGTTATTCTCTATGCTTTATTATGTGGAACCCTTCCATTTGATGATGACCATGTGCCAACTCTTTTTAAGAAGATATGTGATGGGATCTTCTATACCCCTCAATATTTAAATCCTTCTGTGATTAGCCTTTTGAAACATATGCTGCAGGTGGATCCCATGAAGAGGGCCACAATCAAAGATATCAGGGAACATGAATGGTTTAAACAGGACCTTCCAAAATATCTCTTTCCTGAGGATCCATCATATAGTTCAACCATGATTGATGATGAAGCCTTAAAAGAAGTATGTGAAAAGTTTGAGTGCTCAGAAGAGGAAGTTCTCAGCTGTCTTTACAACAGAAATCACCAGGATCCTTTGGCAGTTGCCTACCATCTCATAATAGATAACAGGAGAATAATGAATGAAGCCAAAGATTTCTATTTGGCGACAAGCCCACCTGATTCTTTTCTTGATGATCATCACCTGACTCGGCCCCATCCTGAAAGAGTACCATTCTTGGTTGCTGAAACACCAAGGGCACGCCATACCCTTGATGAATTAAATCCACAGAAATCCAAACACCAAGGTGTAAGGAAAGCAAAATGGCATTTAGGAATTAGAAGTCAAAGTCGACCAAATGATATTATGGCAGAAGTATGTAGAGCAATCAAACAATTGGATTATGAATGGAAGGTTGTAAACCCATATTATTTGCGTGTACGAAGGAAGAATCCTGTGACAAGCACTTACTCCAAAATGAGTCTACAGTTATACCAAGTGGATAGTAGAACTTATCTACTGGATTTCCGTAGTATTGATGATGAAATTACAGAAGCCAAATCAGGGACTGCTACTCCACAGAGATCGGGATCAGTTAGCAACTATCGATCTTGCCAAAGGAGTGATTCAGATGCTGAGGCTCAAGGAAAATCCTCAGAAGTTTCTCTTACCTCATCTGTGACCTCACTTGACTCTTCTCCTGTTGACCTAACTCCAAGACCTGGAAGTCACACAATAGAATTTTTTGAGATGTGTGCAAATCTAATTAAAATTCTTGCACAATAA
ORF Protein Sequence MRRLSSWRKMATAEKQKHDGRVKIGHYILGDTLGVGTFGKVKVGKHELTGHKVAVKILNRQKIRSLDVVGKIRREIQNLKLFRHPHIIKLYQVISTPSDIFMVMEYVSGGELFDYICKNGRLDEKESRRLFQQILSGVDYCHRHMVVHRDLKPENVLLDAHMNAKIADFGLSNMMSDGEFLRTSCGSPNYAAPEVISGRLYAGPEVDIWSSGVILYALLCGTLPFDDDHVPTLFKKICDGIFYTPQYLNPSVISLLKHMLQVDPMKRATIKDIREHEWFKQDLPKYLFPEDPSYSSTMIDDEALKEVCEKFECSEEEVLSCLYNRNHQDPLAVAYHLIIDNRRIMNEAKDFYLATSPPDSFLDDHHLTRPHPERVPFLVAETPRARHTLDELNPQKSKHQGVRKAKWHLGIRSQSRPNDIMAEVCRAIKQLDYEWKVVNPYYLRVRRKNPVTSTYSKMSLQLYQVDSRTYLLDFRSIDDEITEAKSGTATPQRSGSVSNYRSCQRSDSDAEAQGKSSEVSLTSSVTSLDSSPVDLTPRPGSHTIEFFEMCANLIKILAQ

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-TA017-Ab Anti-PRKAA1 monoclonal antibody
    Target Antigen GM-Tg-g-TA017-Ag PRKAA1 protein
    ORF Viral Vector pGMLP005602 Human PRKAA1 Lentivirus plasmid
    ORF Viral Vector pGMLV000515 Human PRKAA1 Lentivirus plasmid
    ORF Viral Vector pGMLV000577 Human PRKAA1 Lentivirus plasmid
    ORF Viral Vector pGMLV001150 Human PRKAA1 Lentivirus plasmid
    ORF Viral Vector pGMLP-SPh-132 Human PRKAA1 Lentivirus plasmid
    ORF Viral Vector pGMAP-SPh-272 Human PRKAA1 Adenovirus plasmid
    ORF Viral Vector pGMPC000051 Human PRKAA1 Mammalian (Non-Viral Vector) plasmid
    ORF Viral Vector vGMLP005602 Human PRKAA1 Lentivirus particle
    ORF Viral Vector vGMLV000515 Human PRKAA1 Lentivirus particle
    ORF Viral Vector vGMLV000577 Human PRKAA1 Lentivirus particle
    ORF Viral Vector vGMLV001150 Human PRKAA1 Lentivirus particle
    ORF Viral Vector vGMLP-SPh-132 Human PRKAA1 Lentivirus particle
    ORF Viral Vector vGMAP-SPh-272 Human PRKAA1 Adenovirus particle


    Target information

    Target ID GM-TA017
    Target Name PRKAA1
    Gene ID 5562, 105787, 695558, 65248, 101095885, 479351, 540404, 100009710
    Gene Symbol and Synonyms AMPK,AMPK alpha 1,AMPKa1,AMPKalpha1,C130083N04Rik,PRKAA1
    Uniprot Accession Q13131
    Uniprot Entry Name AAPK1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000132356
    Target Classification Kinase

    The protein encoded by this gene belongs to the ser/thr protein kinase family. It is the catalytic subunit of the 5'-prime-AMP-activated protein kinase (AMPK). AMPK is a cellular energy sensor conserved in all eukaryotic cells. The kinase activity of AMPK is activated by the stimuli that increase the cellular AMP/ATP ratio. AMPK regulates the activities of a number of key metabolic enzymes through phosphorylation. It protects cells from stresses that cause ATP depletion by switching off ATP-consuming biosynthetic pathways. Alternatively spliced transcript variants encoding distinct isoforms have been observed. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.