Human GAD1 ORF/cDNA clone-Adenovirus particle (BC002815)

Cat. No.: vGMAP000105

Pre-made Human GAD1/ Adenovirus for GAD1 overexpression in-vitro and in-vivo. The GAD1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified GAD1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.

At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.

Target products collection

Go to GAD1/ products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name Adenovirus Grade Adenovirus quantity
vGMAP000105 Human GAD1 Adenovirus particle Research Grade-In vitro 1E+10PFU (1E+10pfu/ml×1ml)
5E+10PFU (1E+10pfu/ml×5ml)
1E+11PFU (1E+10pfu/ml×10ml)
Research Grade-In vivo 1E+11PFU (1E+11pfu/ml×1ml)
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMAP000105
Gene Name GAD1
Accession Number BC002815
Gene ID 2571
Species Human
Product Type Adenovirus particle (overexpression)
Insert Length 675 bp
Gene Alias
Fluorescent Reporter GFP
Mammalian Cell Selection Null
Fusion Tag 3xflag (C-Terminal)
Promoter EF1
Resistance Kanamycin
ORF Nucleotide Sequence ATGGCGTCTTCGACCCCATCTTCGTCCGCAACCTCCTCGAACGCGGGAGCGGACCCCAATACCACTAACCTGCGCCCCACAACGTACGATACCTGGTGCGGCGTGGCCCATGGATGCACCAGAAAACTGGGGCTCAAGATCTGCGGCTTCTTGCAAAGGACCAACAGCCTGGAAGAGAAGAGTCGCCTTGTGAGTGCCTTCAAGGAGAGGCAATCCTCCAAGAACCTGCTTTCCTGTGAAAACAGCGACCGGGATGCCCGCTTCCGGCGCACAGAGACTGACTTCTCTAATCTGTTTGCTAGAGATCTGCTTCCGGCTAAGAACGGTGAGGAGCAAACCGTGCAATTCCTCCTGGAAGTGGTGGACATACTCCTCAACTATGTCCGCAAGACATTTGATCGCTCCACCAAGGTGCTGGACTTTCATCACCCACACCAGTTGCTGGAAGGCATGGAGGGCTTCAACTTGGAGCTCTCTGACCACCCCGAGTCCCTGGAGCAGATCCTGGTTGACTGCAGAGACACCTTGAAGTATGGGGTTCGCACAGGTCATCCTCGATTTTTCAACCAGCTCTCCACTGGATTGGATATTATTGGCCTAGCTGGAGAATGGCTGACATCAACGGCCAATACCAACATGCCATCAGACATGAGGGAGTGTTGGTTGCTACGGTGA
ORF Protein Sequence MASSTPSSSATSSNAGADPNTTNLRPTTYDTWCGVAHGCTRKLGLKICGFLQRTNSLEEKSRLVSAFKERQSSKNLLSCENSDRDARFRRTETDFSNLFARDLLPAKNGEEQTVQFLLEVVDILLNYVRKTFDRSTKVLDFHHPHQLLEGMEGFNLELSDHPESLEQILVDCRDTLKYGVRTGHPRFFNQLSTGLDIIGLAGEWLTSTANTNMPSDMRECWLLR

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T26900-Ab Anti-GAD1 monoclonal antibody
    Target Antigen GM-Tg-g-T26900-Ag GAD1 protein
    ORF Viral Vector pGMAP000105 Human GAD1 Adenovirus plasmid
    ORF Viral Vector vGMAP000105 Human GAD1 Adenovirus particle


    Target information

    Target ID GM-T26900
    Target Name GAD1
    Gene ID 2571, 14415, 613030, 24379, 493699, 478794, 517552, 100052860
    Gene Symbol and Synonyms CPSQ1,DEE89,EP10,GAD,Gad-1,GAD1,GAD67,SCP
    Uniprot Accession Q99259
    Uniprot Entry Name DCE1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000128683
    Target Classification Not Available

    This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantigen and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Deficiency in this enzyme has been shown to lead to pyridoxine dependency with seizures. Alternative splicing of this gene results in two products, the predominant 67-kD form and a less-frequent 25-kD form. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.