Human GAD1 ORF/cDNA clone-Adenovirus particle (BC002815)
Cat. No.: vGMAP000105
Pre-made Human GAD1/ Adenovirus for GAD1 overexpression in-vitro and in-vivo. The GAD1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified GAD1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
GAD1/ products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000105 | Human GAD1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000105 |
Gene Name | GAD1 |
Accession Number | BC002815 |
Gene ID | 2571 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 675 bp |
Gene Alias | |
Fluorescent Reporter | GFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Kanamycin |
ORF Nucleotide Sequence | ATGGCGTCTTCGACCCCATCTTCGTCCGCAACCTCCTCGAACGCGGGAGCGGACCCCAATACCACTAACCTGCGCCCCACAACGTACGATACCTGGTGCGGCGTGGCCCATGGATGCACCAGAAAACTGGGGCTCAAGATCTGCGGCTTCTTGCAAAGGACCAACAGCCTGGAAGAGAAGAGTCGCCTTGTGAGTGCCTTCAAGGAGAGGCAATCCTCCAAGAACCTGCTTTCCTGTGAAAACAGCGACCGGGATGCCCGCTTCCGGCGCACAGAGACTGACTTCTCTAATCTGTTTGCTAGAGATCTGCTTCCGGCTAAGAACGGTGAGGAGCAAACCGTGCAATTCCTCCTGGAAGTGGTGGACATACTCCTCAACTATGTCCGCAAGACATTTGATCGCTCCACCAAGGTGCTGGACTTTCATCACCCACACCAGTTGCTGGAAGGCATGGAGGGCTTCAACTTGGAGCTCTCTGACCACCCCGAGTCCCTGGAGCAGATCCTGGTTGACTGCAGAGACACCTTGAAGTATGGGGTTCGCACAGGTCATCCTCGATTTTTCAACCAGCTCTCCACTGGATTGGATATTATTGGCCTAGCTGGAGAATGGCTGACATCAACGGCCAATACCAACATGCCATCAGACATGAGGGAGTGTTGGTTGCTACGGTGA |
ORF Protein Sequence | MASSTPSSSATSSNAGADPNTTNLRPTTYDTWCGVAHGCTRKLGLKICGFLQRTNSLEEKSRLVSAFKERQSSKNLLSCENSDRDARFRRTETDFSNLFARDLLPAKNGEEQTVQFLLEVVDILLNYVRKTFDRSTKVLDFHHPHQLLEGMEGFNLELSDHPESLEQILVDCRDTLKYGVRTGHPRFFNQLSTGLDIIGLAGEWLTSTANTNMPSDMRECWLLR |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T26900-Ab | Anti-GAD1 monoclonal antibody |
Target Antigen | GM-Tg-g-T26900-Ag | GAD1 protein |
ORF Viral Vector | pGMAP000105 | Human GAD1 Adenovirus plasmid |
ORF Viral Vector | vGMAP000105 | Human GAD1 Adenovirus particle |
Target information
Target ID | GM-T26900 |
Target Name | GAD1 |
Gene ID | 2571, 14415, 613030, 24379, 493699, 478794, 517552, 100052860 |
Gene Symbol and Synonyms | CPSQ1,DEE89,EP10,GAD,Gad-1,GAD1,GAD67,SCP |
Uniprot Accession | Q99259 |
Uniprot Entry Name | DCE1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Not Available |
Gene Ensembl | ENSG00000128683 |
Target Classification | Not Available |
This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantigen and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Deficiency in this enzyme has been shown to lead to pyridoxine dependency with seizures. Alternative splicing of this gene results in two products, the predominant 67-kD form and a less-frequent 25-kD form. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.