Human IDS/MPS2 ORF/cDNA clone-Adenovirus particle (BC006170)
Cat. No.: vGMAP000164
Pre-made Human IDS/MPS2 Adenovirus for IDS overexpression in-vitro and in-vivo. The IDS adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IDS-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
IDS/MPS2 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
| Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
| vGMAP000164 | Human IDS Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
| 5E+10PFU (1E+10pfu/ml×5ml) | |||
| 1E+11PFU (1E+10pfu/ml×10ml) | |||
| Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMAP000164 |
| Gene Name | IDS |
| Accession Number | BC006170 |
| Gene ID | 3423 |
| Species | Human |
| Product Type | Adenovirus particle (overexpression) |
| Insert Length | 939 bp |
| Gene Alias | MPS2 |
| Fluorescent Reporter | GFP |
| Mammalian Cell Selection | Null |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | EF1 |
| Resistance | Kanamycin |
| ORF Nucleotide Sequence | ATGCCGCCACCCCGGACCGGCCGAGGCCTTCTCTGGCTGGGTCTGGTTCTGAGCTCCGTCTGCGTCGCCCTCGGATCCGAAACGCAGGCCAACTCGACCACAGATGCTCTGAACGTTCTTCTCATCATCGTGGATGACCTGCGCCCCTCCCTGGGCTGTTATGGGGATAAGCTGGTGAGGTCCCCAAATATTGACCAACTGGCATCCCACAGCCTCCTCTTCCAGAATGCCTTTGCGCAGCAAGCAGTGTGCGCCCCGAGCCGCGTTTCTTTCCTCACTGGCAGGAGACCTGACACCACCCGCCTGTACGACTTCAACTCCTACTGGAGGGTGCACGCTGGAAACTTCTCCACCATCCCCCAGTACTTCAAGGAGAATGGCTATGTGACCATGTCGGTGGGAAAAGTCTTTCACCCTGGGATATCTTCTAACCATACCGATGATTCTCCGTATAGCTGGTCTTTTCCACCTTATCATCCTTCCTCTGAGAAGTATGAAAACACTAAGACATGTCGAGGGCCAGATGGAGAACTCCATGCCAACCTGCTTTGCCCTGTGGATGTGCTGGATGTTCCCGAGGGCACCTTGCCTGACAAACAGAGCACTGAGCAAGCCATACAGTTGTTGGAAAAGATGAAAACGTCAGCCAGTCCTTTCTTCCTGGCCGTTGGGTATCATAAGCCACACATCCCCTTCAGATACCCCAAGGAATTTCAGAAGTTGTATCCCTTGGAGAACATCACCCTGGCCCCCGATCCCGAGGTCCCTGATGGCCTACCCCCTGTGGCCTACAACCCCTGGATGGACATCAGGCAACGGGAAGACGTCCAAGCCTTAAACATCAGTGTGCCGTATGGTCCAATTCCTGTGGACTTTCAGGAGGACCAAAGTTCCACAGGTTTCAGACTGAAGACTTCATCTACCAGAAAGTATAAGTAG |
| ORF Protein Sequence | MPPPRTGRGLLWLGLVLSSVCVALGSETQANSTTDALNVLLIIVDDLRPSLGCYGDKLVRSPNIDQLASHSLLFQNAFAQQAVCAPSRVSFLTGRRPDTTRLYDFNSYWRVHAGNFSTIPQYFKENGYVTMSVGKVFHPGISSNHTDDSPYSWSFPPYHPSSEKYENTKTCRGPDGELHANLLCPVDVLDVPEGTLPDKQSTEQAIQLLEKMKTSASPFFLAVGYHKPHIPFRYPKEFQKLYPLENITLAPDPEVPDGLPPVAYNPWMDIRQREDVQALNISVPYGPIPVDFQEDQSSTGFRLKTSSTRKYK |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T28993-Ab | Anti-IDS/ MPS2/ SIDS functional antibody |
| Target Antigen | GM-Tg-g-T28993-Ag | IDS protein |
| ORF Viral Vector | pGMAP000164 | Human IDS Adenovirus plasmid |
| ORF Viral Vector | vGMAP000164 | Human IDS Adenovirus particle |
Target information
| Target ID | GM-T28993 |
| Target Name | IDS |
| Gene ID | 3423, 15931, 700892, 363513, 101081450, 492194, 541272, 111771607 |
| Gene Symbol and Synonyms | ID2S,IDS,MPS2,SIDS |
| Uniprot Accession | P22304 |
| Uniprot Entry Name | IDS_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Therapeutics Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000010404 |
| Target Classification | Not Available |
This gene encodes a member of the sulfatase family of proteins. The encoded preproprotein is proteolytically processed to generate two polypeptide chains. This enzyme is involved in the lysosomal degradation of heparan sulfate and dermatan sulfate. Mutations in this gene are associated with the X-linked lysosomal storage disease mucopolysaccharidosis type II, also known as Hunter syndrome. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


