Human IKZF1/hIk-1/Hs.54452 ORF/cDNA clone-Adenovirus particle (BC018349)
Cat. No.: vGMAP000221
Pre-made Human IKZF1/hIk-1/Hs.54452 Adenovirus for IKZF1 overexpression in-vitro and in-vivo. The IKZF1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified IKZF1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go to
IKZF1/hIk-1 products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000221 | Human IKZF1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000221 |
Gene Name | IKZF1 |
Accession Number | BC018349 |
Gene ID | 10320 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1434 bp |
Gene Alias | hIk-1,Hs.54452,IK1,IKAROS,LYF1,PRO0758 |
Fluorescent Reporter | GFP |
Mammalian Cell Selection | Null |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | EF1 |
Resistance | Kanamycin |
ORF Nucleotide Sequence | ATGGATGCTGATGAGGGTCAAGACATGTCCCAAGTTTCAGGGAAGGAAAGCCCCCCTGTAAGCGATACTCCAGATGAGGGCGATGAGCCCATGCCGATCCCCGAGGACCTCTCCACCACCTCGGGAGGACAGCAAAGCTCCAAGAGTGACAGAGTCGTGGCCAGTAATGTTAAAGTAGAGACTCAGAGTGATGAAGAGAATGGGCGTGCCTGTGAAATGAATGGGGAAGAATGTGCGGAGGATTTACGAATGCTTGATGCCTCGGGAGAGAAAATGAATGGCTCCCACAGGGACCAAGGCAGCTCGGCTTTGTCGGGAGTTGGAGGCATTCGACTTCCTAACGGAAAACTAAAGTGTGATATCTGTGGGATCATTTGCATCGGGCCCAATGTGCTCATGGTTCACAAAAGAAGCCACACTGGAGAACGGCCCTTCCAGTGCAATCAGTGCGGGGCCTCATTCACCCAGAAGGGCAACCTGCTCCGGCACATCAAGCTGCATTCCGGGGAGAAGCCCTTCAAATGCCACCTCTGCAACTACGCCTGCCGCCGGAGGGACGCCCTCACTGGCCACCTGAGGACGCACTCCGTCATTAAAGAAGAAACTAATCACAGTGAAATGGCAGAAGACCTGTGCAAGATAGGATCAGAGAGATCTCTCGTGCTGGACAGACTAGCAAGTAACGTCGCCAAACGTAAGAGCTCTATGCCTCAGAAATTTCTTGGGGACAAGGGCCTGTCCGACACGCCCTACGACAGCAGCGCCAGCTACGAGAAGGAGAACGAAATGATGAAGTCCCACGTGATGGACCAAGCCATCAACAACGCCATCAACTACCTGGGGGCCGAGTCCCTGCGCCCGCTGGTGCAGACGCCCCCGGGCGGTTCCGAGGTGGTCCCGGTCATCAGCCCGATGTACCAGCTGCACAAGCCGCTCGCGGAGGGCACCCCGCGCTCCAACCACTCGGCCCAGGACAGCGCCGTGGAGAACCTGCTGCTGCTCTCCAAGGCCAAGTTGGTGCCCTCGGAGCGCGAGGCGTCCCCGAGCAACAGCTGCCAAGACTCCACGGACACCGAGAGCAACAACGAGGAGCAGCGCAGCGGTCTCATCTACCTGACCAACCACATCGCCCCGCACGCGCGCAACGGGCTGTCGCTCAAGGAGGAGCACCGCGCCTACGACCTGCTGCGCGCCGCCTCCGAGAACTCGCAGGACGCGCTCCGCGTGGTCAGCACCAGCGGGGAGCAGATGAAGGTGTACAAGTGCGAACACTGCCGGGTGCTCTTCCTGGATCACGTCATGTACACCATCCACATGGGCTGCCACGGCTTCCGTGATCCTTTTGAGTGCAACATGTGCGGCTACCACAGCCAGGACCGGTACGAGTTCTCGTCGCACATAACGCGAGGGGAGCACCGCTTCCACATGAGCTAA |
ORF Protein Sequence | MDADEGQDMSQVSGKESPPVSDTPDEGDEPMPIPEDLSTTSGGQQSSKSDRVVASNVKVETQSDEENGRACEMNGEECAEDLRMLDASGEKMNGSHRDQGSSALSGVGGIRLPNGKLKCDICGIICIGPNVLMVHKRSHTGERPFQCNQCGASFTQKGNLLRHIKLHSGEKPFKCHLCNYACRRRDALTGHLRTHSVIKEETNHSEMAEDLCKIGSERSLVLDRLASNVAKRKSSMPQKFLGDKGLSDTPYDSSASYEKENEMMKSHVMDQAINNAINYLGAESLRPLVQTPPGGSEVVPVISPMYQLHKPLAEGTPRSNHSAQDSAVENLLLLSKAKLVPSEREASPSNSCQDSTDTESNNEEQRSGLIYLTNHIAPHARNGLSLKEEHRAYDLLRAASENSQDALRVVSTSGEQMKVYKCEHCRVLFLDHVMYTIHMGCHGFRDPFECNMCGYHSQDRYEFSSHITRGEHRFHMS |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP1008-Ab | Anti-IKZF1 monoclonal antibody |
Target Antigen | GM-Tg-g-IP1008-Ag | IKZF1 protein |
ORF Viral Vector | pGMAP000221 | Human IKZF1 Adenovirus plasmid |
ORF Viral Vector | vGMAP000221 | Human IKZF1 Adenovirus particle |
Target information
Target ID | GM-IP1008 |
Target Name | IKZF1 |
Gene ID | 10320, 22778, 693936, 305501, 101085701, 483231, 541154, 100052437 |
Gene Symbol and Synonyms | 5832432G11Rik,CVID13,hlk-1,Hs.54452,IK1,IKAROS,IKZF1,LyF-1,LYF1,mKIAA4227,PPP1R92,PRO0758,RGD1562979,Zfpn1a1,ZNFN1A1 |
Uniprot Accession | Q13422 |
Uniprot Entry Name | IKZF1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Cancer |
Gene Ensembl | ENSG00000185811 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a transcription factor that belongs to the family of zinc-finger DNA-binding proteins associated with chromatin remodeling. The expression of this protein is restricted to the fetal and adult hemo-lymphopoietic system, and it functions as a regulator of lymphocyte differentiation. Several alternatively spliced transcript variants encoding different isoforms have been described for this gene. Most isoforms share a common C-terminal domain, which contains two zinc finger motifs that are required for hetero- or homo-dimerization, and for interactions with other proteins. The isoforms, however, differ in the number of N-terminal zinc finger motifs that bind DNA and in nuclear localization signal presence, resulting in members with and without DNA-binding properties. Only a few isoforms contain the requisite three or more N-terminal zinc motifs that confer high affinity binding to a specific core DNA sequence element in the promoters of target genes. The non-DNA-binding isoforms are largely found in the cytoplasm, and are thought to function as dominant-negative factors. Overexpression of some dominant-negative isoforms have been associated with B-cell malignancies, such as acute lymphoblastic leukemia (ALL). [provided by RefSeq, May 2014]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.