Human UGT1A1/HUG-BR1/ UDPGT ORF/cDNA clone-Adenovirus particle (BC128415)
Pre-made Human UGT1A1/HUG-BR1/ UDPGT Adenovirus for UGT1A1 overexpression in-vitro and in-vivo. The UGT1A1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified UGT1A1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to UGT1A1/HUG-BR1 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000477 | Human UGT1A1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000477 |
Gene Name | UGT1A1 |
Accession Number | BC128415 |
Gene ID | 54658 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1602 bp |
Gene Alias | HUG-BR1, UDPGT, UGT1*1, UGT1A |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCTGTGGAGTCCCAGGGCGGACGCCCACTTGTCCTGGGCCTGCTGCTGTGTGTGCTGGGCCCAGTGGTGTCCCATGCTGGGAAGATACTGTTGATCCCAGTGGATGGCAGCCACTGGCTGAGCATGCTTGGGGCCATCCAGCAGCTGCAGCAGAGGGGACATGAAATAGTTGTCCTAGCACCTGACGCCTCGTTGTACATCAGAGACGGAGCATTTTACACCTTGAAGACGTACCCTGTGCCATTCCAAAGGGAGGATGTGAAAGAGTCTTTTGTTAGTCTCGGGCATAATGTTTTTGAGAATGATTCTTTCCTGCAGCGTGTGATCAAAACATACAAGAAAATAAAAAAGGACTCTGCTATGCTTTTGTCTGGCTGTTCCCACTTACTGCACAACAAGGAGCTCATGGCCTCCCTGGCAGAAAGCAGCTTTGATGTCATGCTGACGGACCCTTTCCTTCCTTGCAGCCCCATCGTGGCCCAGTACCTGTCTCTGCCCACTGTATTCTTCTTGCATGCACTGCCATGCAGCCTGGAATTTGAGGCTACCCAGTGCCCCAACCCATTCTCCTACGTGCCCAGGCCTCTCTCCTCTCATTCAGATCACATGACCTTCCTGCAGCGGGTGAAGAACATGCTCATTGCCTTTTCACAGAACTTTCTGTGCGACGTGGTTTATTCCCCGTATGCAACCCTTGCCTCAGAATTCCTTCAGAGAGAGGTGACTGTCCAGGACCTATTGAGCTCTGCATCTGTCTGGCTGTTTAGAAGTGACTTTGTGAAGGATTACCCTAGGCCCATCATGCCCAATATGGTTTTTGTTGGTGGAATCAACTGCCTTCACCAAAATCCACTATCCCAGGAATTTGAAGCCTACATTAATGCTTCTGGAGAACATGGAATTGTGGTTTTCTCTTTGGGATCAATGGTCTCAGAAATTCCAGAGAAGAAAGCTATGGCAATTGCTGATGCTTTGGGCAAAATCCCTCAGACAGTCCTGTGGCGGTACACTGGAACCCGACCATCGAATCTTGCGAACAACACGATACTTGTTAAGTGGCTACCCCAAAACGATCTGCTTGGTCACCCGATGACCCGTGCCTTTATCACCCATGCTGGTTCCCATGGTGTTTATGAAAGCATATGCAATGGCGTTCCCATGGTGATGATGCCCTTGTTTGGTGATCAGATGGACAATGCAAAGCGCATGGAGACTAAGGGAGCTGGAGTGACCCTGAATGTTCTGGAAATGACTTCTGAAGATTTAGAAAATGCTCTAAAAGCAGTCATCAATGACAAAAGTTACAAGGAGAACATCATGCGCCTCTCCAGCCTTCACAAGGACCGCCCGGTGGAGCCGCTGGACCTGGCCGTGTTCTGGGTGGAGTTTGTGATGAGGCACAAGGGCGCGCCACACCTGCGCCCCGCAGCCCACGACCTCACCTGGTACCAGTACCATTCCTTGGACGTGATTGGTTTCCTCTTGGCCGTCGTGCTGACAGTGGCCTTCATCACCTTTAAATGTTGTGCTTATGGCTACCGGAAATGCTTGGGGAAAAAAGGGCGAGTTAAGAAAGCCCACAAATCCAAGACCCATTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP0035-Ab | Anti-UGT1A1 monoclonal antibody |
Target Antigen | GM-Tg-g-IP0035-Ag | UGT1A1 protein |
ORF Viral Vector | pGMAP000477 | Human UGT1A1 Adenovirus plasmid |
ORF Viral Vector | vGMAP000477 | Human UGT1A1 Adenovirus particle |
Target information
Target ID | GM-IP0035 |
Target Name | UGT1A1 |
Gene ID | 54658, 24861 |
Gene Symbol and Synonyms | BILIQTL1,GNT1,HUG-BR1,UDPGT,UDPGT 1-1,UGT1,UGT1A,UGT1A1 |
Uniprot Accession | P22309 |
Uniprot Entry Name | UD11_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000241635 |
Target Classification | Tumor-associated antigen (TAA) |
This gene encodes a UDP-glucuronosyltransferase, an enzyme of the glucuronidation pathway that transforms small lipophilic molecules, such as steroids, bilirubin, hormones, and drugs, into water-soluble, excretable metabolites. This gene is part of a complex locus that encodes several UDP-glucuronosyltransferases. The locus includes thirteen unique alternate first exons followed by four common exons. Four of the alternate first exons are considered pseudogenes. Each of the remaining nine 5' exons may be spliced to the four common exons, resulting in nine proteins with different N-termini and identical C-termini. Each first exon encodes the substrate binding site, and is regulated by its own promoter. The preferred substrate of this enzyme is bilirubin, although it also has moderate activity with simple phenols, flavones, and C18 steroids. Mutations in this gene result in Crigler-Najjar syndromes types I and II and in Gilbert syndrome. [provided by RefSeq, Jul 2008]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.