Human GTF2F1/BTF4/ RAP74 ORF/cDNA clone-Adenovirus particle (BC013007)
Pre-made Human GTF2F1/BTF4/ RAP74 Adenovirus for GTF2F1 overexpression in-vitro and in-vivo. The GTF2F1 adenoviral vector excels as a vehicle for transient gene transfection in both stable cell lines and primary cells, including DC cells, macrophages, cardiomyocytes, hepatocytes, and neurons. The purified GTF2F1-encoding adenovirus also stands out as a quintessential tool for in vivo studies and vaccine research initiatives.
At GM Vector Core (GMVC), we provide bespoke adenovirus development and manufacture various grades of adenoviruses utilizing cutting-edge techniques. Dive deeper into our offerings.
Go
to GTF2F1/BTF4 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | Adenovirus Grade | Adenovirus quantity |
vGMAP000505 | Human GTF2F1 Adenovirus particle | Research Grade-In vitro | 1E+10PFU (1E+10pfu/ml×1ml) |
5E+10PFU (1E+10pfu/ml×5ml) | |||
1E+11PFU (1E+10pfu/ml×10ml) | |||
Research Grade-In vivo | 1E+11PFU (1E+11pfu/ml×1ml) | ||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMAP000505 |
Gene Name | GTF2F1 |
Accession Number | BC013007 |
Gene ID | 2962 |
Species | Human |
Product Type | Adenovirus particle (overexpression) |
Insert Length | 1554 bp |
Gene Alias | BTF4, RAP74, TF2F1, TFIIF |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGCGGCCCTAGGCCCTAGCAGCCAGAATGTCACTGAATACGTCGTTCGAGTTCCTAAGAATACAACCAAAAAATATAACATCATGGCTTTTAATGCAGCCGACAAAGTCAACTTTGCTACGTGGAATCAGGCTCGGCTGGAGCGGGACTTGAGCAACAAGAAAATCTACCAAGAGGAGGAGATGCCCGAATCGGGCGCGGGCAGTGAGTTCAACCGCAAGCTTCGGGAGGAGGCTCGGAGGAAGAAGTACGGCATCGTCCTCAAGGAGTTCCGGCCCGAGGACCAGCCCTGGCTGCTCCGGGTCAACGGCAAATCAGGCAGGAAGTTCAAGGGCATCAAGAAGGGAGGCGTAACAGAGAACACGTCCTACTACATCTTCACCCAGTGCCCCGACGGGGCCTTCGAGGCCTTCCCCGTGCACAACTGGTACAATTTCACACCGCTGGCCCGGCATCGCACGCTCACTGCCGAGGAGGCCGAGGAGGAGTGGGAGAGGAGGAACAAGGTGCTGAACCACTTCAGCATCATGCAGCAGCGGCGGCTCAAGGATCAGGACCAGGACGAGGATGAGGAGGAGAAGGAGAAACGTGGCCGCAGGAAGGCGAGCGAGCTGCGCATCCACGACCTGGAGGACGACCTGGAGATGTCGTCCGATGCCAGTGATGCCAGTGGTGAGGAGGGGGGCAGAGTCCCCAAGGCCAAGAAGAAGGCGCCGCTGGCCAAGGGCGGCAGGAAAAAGAAGAAGAAGAAGGGTTCAGACGACGAGGCCTTCGAGGACAGCGATGATGGGGACTTCGAGGGCCAAGAGGTAGACTACATGTCAGACGGCTCCAGTAGCTCCCAAGAAGAGCCTGAGAGCAAGGCCAAGGCGCCGCAGCAGGAGGAGGGGCCCAAGGGTGTCGATGAGCAGAGCGACAGTAGTGAGGAGAGTGAGGAGGAGAAGCCGCCTGAGGAGGACAAGGAGGAGGAGGAGGAGAAGAAGGCACCCACCCCGCAGGAGAAGAAGCGCAGGAAAGACAGCAGCGAGGAGTCGGACAGCTCAGAGGAGAGCGACATTGACAGCGAGGCCTCCTCAGCCCTCTTCATGGCGAAGAAGAAGACGCCACCCAAGAGAGAGCGGAAGCCGTCGGGAGGGAGCTCAAGGGGCAACAGCCGCCCAGGCACGCCCAGCGCAGAGGGTGGCAGCACCTCCTCCACCCTGCGGGCGGCTGCCAGCAAACTCGAGCAAGGGAAGCGGGTGAGCGAGATGCCTGCAGCCAAGCGGTTGCGGCTGGACACGGGACCCCAGAGCCTGTCTGGGAAGTCGACACCCCAGCCACCATCAGGCAAGACAACACCCAACAGCGGCGACGTGCAGGTGACTGAGGATGCCGTGCGCCGCTACCTGACACGGAAGCCCATGACCACTAAGGACCTGCTGAAAAAGTTCCAGACCAAGAAGACAGGGCTGAGCAGCGAGCAGACAGTGAACGTGTTGGCCCAGATCCTCAAGCGACTCAACCCCGAGCGCAAGATGATCAACGACAAAATGCACTTCTCCCTCAAGGAGTGA |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-IP2533-Ab | Anti-GTF2F1 monoclonal antibody |
Target Antigen | GM-Tg-g-IP2533-Ag | GTF2F1 protein |
ORF Viral Vector | pGMAP000505 | Human GTF2F1 Adenovirus plasmid |
ORF Viral Vector | vGMAP000505 | Human GTF2F1 Adenovirus particle |
Target information
Target ID | GM-IP2533 |
Target Name | GTF2F1 |
Gene ID | 2962, 98053, 699221, 316123, 101095797, 476731, 505702, 100065544 |
Gene Symbol and Synonyms | 2810405L04Rik,BTF4,GTF2F1,RAP74,TF2F1,TFIIF |
Uniprot Accession | P35269 |
Uniprot Entry Name | T2FA_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Not Available |
Disease | Not Available |
Gene Ensembl | ENSG00000125651 |
Target Classification | Not Available |
Enables several functions, including RNA polymerase II general transcription initiation factor activity; phosphatase activator activity; and promoter-specific chromatin binding activity. Involved in several processes, including positive regulation of transcription by RNA polymerase II; response to virus; and transcription initiation from RNA polymerase II promoter. Located in cell junction and nucleoplasm. Part of transcription factor TFIID complex. [provided by Alliance of Genome Resources, Apr 2022]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.