Human LGALS2/HL14 ORF/cDNA clone-Lentivirus particle (NM_006498)

Cat. No.: vGMLP000026

Pre-made Human LGALS2/HL14 Lentiviral expression plasmid for LGALS2 lentivirus packaging, LGALS2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to LGALS2/HL14 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000026 Human LGALS2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000026
Gene Name LGALS2
Accession Number NM_006498
Gene ID 3957
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 399 bp
Gene Alias HL14
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGACGGGGGAACTTGAGGTTAAGAACATGGACATGAAGCCGGGGTCAACCCTGAAGATCACAGGCAGCATCGCCGATGGCACTGATGGCTTTGTAATTAATCTGGGCCAGGGGACAGACAAGCTGAACCTGCATTTCAACCCTCGCTTCAGCGAATCCACCATTGTCTGCAACTCATTGGACGGCAGCAACTGGGGGCAAGAACAACGGGAAGATCACCTGTGCTTCAGCCCAGGGTCAGAGGTCAAGTTCACAGTGACCTTTGAGAGTGACAAATTCAAGGTGAAGCTGCCAGATGGGCACGAGCTGACTTTTCCCAACAGGCTGGGTCACAGCCACCTGAGCTACCTGAGCGTAAGGGGCGGGTTCAACATGTCCTCTTTCAAGTTAAAAGAATAA
ORF Protein Sequence MTGELEVKNMDMKPGSTLKITGSIADGTDGFVINLGQGTDKLNLHFNPRFSESTIVCNSLDGSNWGQEQREDHLCFSPGSEVKFTVTFESDKFKVKLPDGHELTFPNRLGHSHLSYLSVRGGFNMSSFKLKE

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T40728-Ab Anti-LGALS2 monoclonal antibody
    Target Antigen GM-Tg-g-T40728-Ag LGALS2 protein
    ORF Viral Vector pGMLP000026 Human LGALS2 Lentivirus plasmid
    ORF Viral Vector vGMLP000026 Human LGALS2 Lentivirus particle


    Target information

    Target ID GM-T40728
    Target Name LGALS2
    Gene ID 3957, 107753, 697820, 171134, 101097906, 474514, 511098, 100069787
    Gene Symbol and Synonyms 2200008F12Rik,galectin-2,HL14,LGALS2
    Uniprot Accession P05162
    Uniprot Entry Name LEG2_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target
    Disease Not Available
    Gene Ensembl ENSG00000100079
    Target Classification Not Available

    The protein encoded by this gene is a soluble beta-galactoside binding lectin. The encoded protein is found as a homodimer and can bind to lymphotoxin-alpha. A single nucleotide polymorphism in an intron of this gene can alter the transcriptional level of the protein, with a resultant increased risk of myocardial infarction. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.