Human SCGB3A2/LU103/ pnSP-1 ORF/cDNA clone-Lentivirus particle (NM_054023)

Pre-made Human SCGB3A2/LU103/ pnSP-1 Lentiviral expression plasmid for SCGB3A2 lentivirus packaging, SCGB3A2 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collectionGo to SCGB3A2/LU103 products collection >>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)



Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000049 Human SCGB3A2 Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000049
Gene Name SCGB3A2
Accession Number NM_054023
Gene ID 117156
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 282 bp
Gene Alias LU103, pnSP-1, PNSP1, UGRP1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
Sequence ATGAAGCTGGTAACTATCTTCCTGCTGGTGACCATCAGCCTTTGTAGTTACTCTGCTACTGCCTTCCTCATCAACAAAGTGCCCCTTCCTGTTGACAAGTTGGCACCTTTACCTCTGGACAACATTCTTCCCTTTATGGATCCATTAAAGCTTCTTCTGAAAACTCTGGGCATTTCTGTTGAGCACCTTGTGGAGGGGCTAAGGAAGTGTGTAAATGAGCTGGGACCAGAGGCTTCTGAAGCTGTGAAGAAACTGCTGGAGGCGCTATCACACTTGGTGTGA

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-SE1270-Ab Anti-SG3A2/ SCGB3A2/ LU103 functional antibody
    Target Antigen GM-Tg-g-SE1270-Ag SCGB3A2 protein
    ORF Viral Vector pGMLP000049 Human SCGB3A2 Lentivirus plasmid
    ORF Viral Vector vGMLP000049 Human SCGB3A2 Lentivirus particle


    Target information

    Target ID GM-SE1270
    Target Name SCGB3A2
    Gene ID 117156, 117158, 709138, 498854, 101086200, 100686652, 788029, 100060839
    Gene Symbol and Synonyms LU103,LuLeu1,pnSP-1,PNSP1,SCGB3A2,UGRP1,Utgrp1
    Uniprot Accession Q96PL1
    Uniprot Entry Name SG3A2_HUMAN
    Protein Sub-location Secreted Protein/Potential Cytokines
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000164265
    Target Classification Not Available

    The protein encoded by this gene is a secreted lung surfactant protein and a downstream target of thyroid transcription factor. A single nucleotide polymorphism in the promoter of this gene results in susceptibility to asthma.[provided by RefSeq, Mar 2010]



    About GMVC

    GDU



    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.