Human GEM/KIR ORF/cDNA clone-Lentivirus particle (NM_181702)
Cat. No.: vGMLP000125
Pre-made Human GEM/KIR Lentiviral expression plasmid for GEM lentivirus packaging, GEM lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
GEM/KIR products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP000125 | Human GEM Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP000125 |
| Gene Name | GEM |
| Accession Number | NM_181702 |
| Gene ID | 2669 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 891 bp |
| Gene Alias | KIR |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGACTCTGAATAATGTCACCATGCGCCAGGGCACTGTGGGCATGCAGCCACAGCAGCAGCGCTGGAGCATCCCAGCTGATGGCAGGCATCTGATGGTCCAGAAAGAGCCCCACCAGTACAGCCACCGCAACCGCCATTCTGCTACCCCTGAGGACCACTGCCGCCGAAGCTGGTCCTCTGACTCCACAGACTCAGTCATCTCCTCTGAGTCAGGGAACACCTACTACCGAGTGGTGCTCATAGGGGAGCAGGGGGTGGGCAAGTCCACTCTGGCCAACATCTTTGCAGGTGTGCATGACAGCATGGACAGCGACTGCGAGGTGCTGGGAGAAGATACATATGAACGAACCCTGATGGTTGATGGGGAAAGTGCAACGATTATACTCCTGGATATGTGGGAAAATAAGGGGGAAAATGAATGGCTCCATGACCACTGCATGCAGGTCGGGGACGCATACCTGATTGTCTACTCAATCACAGACCGAGCGAGCTTCGAGAAGGCATCTGAGCTGCGAATCCAGCTCCGCAGGGCCCGGCAGACAGAGGACATTCCCATAATTTTGGTTGGCAACAAAAGTGACTTAGTGCGGTGCCGAGAAGTGTCTGTATCAGAAGGGAGAGCCTGTGCAGTGGTGTTTGACTGCAAGTTCATCGAGACCTCTGCAGCTGTCCAGCACAACGTGAAGGAGCTGTTTGAGGGCATTGTGCGACAGGTGCGCCTTCGGCGGGACAGCAAGGAGAAGAATGAACGGCGGCTGGCCTACCAGAAAAGGAAGGAGAGCATGCCCAGGAAAGCCAGGCGCTTCTGGGGCAAGATCGTGGCCAAAAACAACAAGAATATGGCCTTCAAGCTCAAGTCCAAATCCTGCCATGACCTCTCTGTACTCTAG |
| ORF Protein Sequence | MTLNNVTMRQGTVGMQPQQQRWSIPADGRHLMVQKEPHQYSHRNRHSATPEDHCRRSWSSDSTDSVISSESGNTYYRVVLIGEQGVGKSTLANIFAGVHDSMDSDCEVLGEDTYERTLMVDGESATIILLDMWENKGENEWLHDHCMQVGDAYLIVYSITDRASFEKASELRIQLRRARQTEDIPIILVGNKSDLVRCREVSVSEGRACAVVFDCKFIETSAAVQHNVKELFEGIVRQVRLRRDSKEKNERRLAYQKRKESMPRKARRFWGKIVAKNNKNMAFKLKSKSCHDLSVL |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-T35063-Ab | Anti-GEM monoclonal antibody |
| Target Antigen | GM-Tg-g-T35063-Ag | GEM protein |
| ORF Viral Vector | pGMLP000125 | Human GEM Lentivirus plasmid |
| ORF Viral Vector | vGMLP000125 | Human GEM Lentivirus particle |
Target information
| Target ID | GM-T35063 |
| Target Name | GEM |
| Gene ID | 2669, 14579, 699130, 297902, 101083484, 611634, 538437, 100050475 |
| Gene Symbol and Synonyms | GEM,KIR |
| Uniprot Accession | P55040 |
| Uniprot Entry Name | GEM_HUMAN |
| Protein Sub-location | Introcelluar Protein |
| Category | Therapeutics Target |
| Disease | Prostate Cancer |
| Gene Ensembl | ENSG00000164949 |
| Target Classification | Not Available |
The protein encoded by this gene belongs to the RAD/GEM family of GTP-binding proteins. It is associated with the inner face of the plasma membrane and could play a role as a regulatory protein in receptor-mediated signal transduction. Alternative splicing occurs at this locus and two transcript variants encoding the same protein have been identified. [provided by RefSeq, Jul 2008]
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


