Human MLANA/MART-1/MART1 ORF/cDNA clone-Lentivirus particle (NM_005511)

Cat. No.: vGMLP000325

Pre-made Human MLANA/MART-1/MART1 Lentiviral expression plasmid for MLANA lentivirus packaging, MLANA lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to MLANA/MART-1 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000325 Human MLANA Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000325
Gene Name MLANA
Accession Number NM_005511
Gene ID 2315
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 357 bp
Gene Alias MART-1,MART1
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGCCAAGAGAAGATGCTCACTTCATCTATGGTTACCCCAAGAAGGGGCACGGCCACTCTTACACCACGGCTGAAGAGGCCGCTGGGATCGGCATCCTGACAGTGATCCTGGGAGTCTTACTGCTCATCGGCTGTTGGTATTGTAGAAGACGAAATGGATACAGAGCCTTGATGGATAAAAGTCTTCATGTTGGCACTCAATGTGCCTTAACAAGAAGATGCCCACAAGAAGGGTTTGATCATCGGGACAGCAAAGTGTCTCTTCAAGAGAAAAACTGTGAACCTGTGGTTCCCAATGCTCCACCTGCTTATGAGAAACTCTCTGCAGAACAGTCACCACCACCTTATTCACCTTAA
ORF Protein Sequence MPREDAHFIYGYPKKGHGHSYTTAEEAAGIGILTVILGVLLLIGCWYCRRRNGYRALMDKSLHVGTQCALTRRCPQEGFDHRDSKVSLQEKNCEPVVPNAPPAYEKLSAEQSPPPYSP

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0079-Ab Anti-MLANA monoclonal antibody
    Target Antigen GM-Tg-g-IP0079-Ag MLANA protein
    ORF Viral Vector pGMLP000325 Human MLANA Lentivirus plasmid
    ORF Viral Vector vGMLP000325 Human MLANA Lentivirus particle


    Target information

    Target ID GM-IP0079
    Target Name MLANA
    Gene ID 2315, 77836, 715882, 293890, 101092899, 403495, 616945, 100051824
    Gene Symbol and Synonyms A930034P04Rik,MART-1,MART1,MLANA
    Uniprot Accession Q16655
    Uniprot Entry Name MAR1_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Therapeutics Target, Immuno-oncology Target
    Disease Cancer
    Gene Ensembl ENSG00000120215
    Target Classification Checkpoint-Immuno Oncology, Tumor-associated antigen (TAA)

    Located in endoplasmic reticulum membrane; melanosome; and trans-Golgi network. [provided by Alliance of Genome Resources, Apr 2022]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.