Human CHMP4B/C20orf178/CHMP4A ORF/cDNA clone-Lentivirus particle (NM_176812)

Cat. No.: vGMLP000414

Pre-made Human CHMP4B/C20orf178/CHMP4A Lentiviral expression plasmid for CHMP4B lentivirus packaging, CHMP4B lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to CHMP4B/C20orf178 products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000414 Human CHMP4B Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000414
Gene Name CHMP4B
Accession Number NM_176812
Gene ID 128866
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 675 bp
Gene Alias C20orf178,CHMP4A,CTPP3,CTRCT31,dJ553F4.4,Shax1,SNF7,SNF7-2,Vps32-2,VPS32B
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGTCGGTGTTCGGGAAGCTGTTCGGGGCTGGAGGGGGTAAGGCCGGCAAGGGCGGCCCGACCCCCCAGGAGGCCATCCAGCGGCTGCGGGACACGGAAGAGATGTTAAGCAAGAAACAGGAGTTCCTGGAGAAGAAAATCGAGCAGGAGCTGACGGCCGCCAAGAAGCACGGCACCAAAAACAAGCGCGCGGCCCTCCAGGCACTGAAGCGTAAGAAGAGGTATGAGAAGCAGCTGGCGCAGATCGACGGCACATTATCAACCATCGAGTTCCAGCGGGAGGCCCTGGAGAATGCCAACACCAACACCGAGGTGCTCAAGAACATGGGCTATGCCGCCAAGGCCATGAAGGCGGCCCATGACAACATGGACATCGATAAAGTTGATGAGTTAATGCAGGACATTGCTGACCAGCAAGAACTTGCAGAGGAGATTTCAACAGCAATTTCGAAACCTGTAGGGTTTGGAGAAGAGTTTGACGAGGATGAGCTCATGGCGGAATTAGAAGAACTAGAACAGGAGGAACTAGACAAGAATTTGCTGGAAATCAGTGGACCCGAAACAGTCCCTCTACCAAATGTTCCCTCTATAGCCCTACCATCAAAACCCGCCAAGAAGAAAGAAGAGGAGGACGACGACATGAAGGAATTGGAGAACTGGGCTGGATCCATGTAA
ORF Protein Sequence MSVFGKLFGAGGGKAGKGGPTPQEAIQRLRDTEEMLSKKQEFLEKKIEQELTAAKKHGTKNKRAALQALKRKKRYEKQLAQIDGTLSTIEFQREALENANTNTEVLKNMGYAAKAMKAAHDNMDIDKVDELMQDIADQQELAEEISTAISKPVGFGEEFDEDELMAELEELEQEELDKNLLEISGPETVPLPNVPSIALPSKPAKKKEEEDDDMKELENWAGSM

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-T47731-Ab Anti-CHMP4B monoclonal antibody
    Target Antigen GM-Tg-g-T47731-Ag CHMP4B protein
    ORF Viral Vector pGMLP000414 Human CHMP4B Lentivirus plasmid
    ORF Viral Vector vGMLP000414 Human CHMP4B Lentivirus particle


    Target information

    Target ID GM-T47731
    Target Name CHMP4B
    Gene ID 128866, 75608, 709004, 100359642, 101097964, 485842, 616164, 100069227
    Gene Symbol and Synonyms 2010012F05Rik,C20orf178,CHMP4A,CHMP4B,CTPP3,CTRCT31,dJ553F4.4,RGD1309846,RGD1565889,Shax1,SNF7,SNF7-2,Vps32-2,VPS32B
    Uniprot Accession Q9H444
    Uniprot Entry Name CHM4B_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000101421
    Target Classification Not Available

    This gene encodes a member of the chromatin-modifying protein/charged multivesicular body protein (CHMP) protein family. The protein is part of the endosomal sorting complex required for transport (ESCRT) complex III (ESCRT-III), which functions in the sorting of endocytosed cell-surface receptors into multivesicular endosomes. The ESCRT machinery also functions in the final abscisson stage of cytokinesis and in the budding of enveloped viruses such as HIV-1. The three proteins of the CHMP4 subfamily interact with programmed cell death 6 interacting protein (PDCD6IP, also known as ALIX), which also functions in the ESCRT pathway. The CHMP4 proteins assemble into membrane-attached 5-nm filaments that form circular scaffolds and promote or stabilize outward budding. These polymers are proposed to help generate the luminal vesicles of multivesicular bodies. Mutations in this gene result in autosomal dominant posterior polar cataracts.[provided by RefSeq, Oct 2009]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.