Human IFNA1/IFL/IFN ORF/cDNA clone-Lentivirus particle (NM_024013)
Cat. No.: vGMLP000551
Pre-made Human IFNA1/IFL/IFN Lentiviral expression plasmid for IFNA1 lentivirus packaging, IFNA1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go to
IFNA13/IFNA1/IFL products
collection>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
| Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
|---|---|---|---|
| vGMLP000551 | Human IFNA1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| Research Grade | 1.0E+8TU | ||
| 5.0E+8TU | |||
| 1.0E+9TU | |||
| GMP-like Grade | inquiry | ||
| GMP Grade | inquiry |
Product Description
| Catalog ID | vGMLP000551 |
| Gene Name | IFNA1 |
| Accession Number | NM_024013 |
| Gene ID | 3439 |
| Species | Human |
| Product Type | Lentivirus particle (overexpression) |
| Insert Length | 570 bp |
| Gene Alias | IFL,IFN,IFN-ALPHA,IFN-alphaD,IFNA13,IFNA@ |
| Fluorescent Reporter | ZsGreen |
| Mammalian Cell Selection | Puromyocin |
| Fusion Tag | 3xflag (C-Terminal) |
| Promoter | CMV |
| Resistance | Amplicin |
| ORF Nucleotide Sequence | ATGGCCTCGCCCTTTGCTTTACTGATGGTCCTGGTGGTGCTCAGCTGCAAGTCAAGCTGCTCTCTGGGCTGTGATCTCCCTGAGACCCACAGCCTGGATAACAGGAGGACCTTGATGCTCCTGGCACAAATGAGCAGAATCTCTCCTTCCTCCTGTCTGATGGACAGACATGACTTTGGATTTCCCCAGGAGGAGTTTGATGGCAACCAGTTCCAGAAGGCTCCAGCCATCTCTGTCCTCCATGAGCTGATCCAGCAGATCTTCAACCTCTTTACCACAAAAGATTCATCTGCTGCTTGGGATGAGGACCTCCTAGACAAATTCTGCACCGAACTCTACCAGCAGCTGAATGACTTGGAAGCCTGTGTGATGCAGGAGGAGAGGGTGGGAGAAACTCCCCTGATGAATGCGGACTCCATCTTGGCTGTGAAGAAATACTTCCGAAGAATCACTCTCTATCTGACAGAGAAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGAGATCCCTCTCTTTATCAACAAACTTGCAAGAAAGATTAAGGAGGAAGGAATAA |
| ORF Protein Sequence | MASPFALLMVLVVLSCKSSCSLGCDLPETHSLDNRRTLMLLAQMSRISPSSCLMDRHDFGFPQEEFDGNQFQKAPAISVLHELIQQIFNLFTTKDSSAAWDEDLLDKFCTELYQQLNDLEACVMQEERVGETPLMNADSILAVKKYFRRITLYLTEKKYSPCAWEVVRAEIMRSLSLSTNLQERLRRKE |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
| Category | Cat No. | Products Name |
|---|---|---|
| Target Antibody | GM-Tg-g-SE0977-Ab | Anti-IFNA1/ IFNA13 functional antibody |
| Target Antigen | GM-Tg-g-SE0977-Ag | IFNA13 protein |
| Cytokine | cks-Tg-g-GM-SE0977 | interferon, alpha 13 (IFNA13) protein & antibody |
| ORF Viral Vector | pGMLP000155 | Human IFNA13 Lentivirus plasmid |
| ORF Viral Vector | pGMLP000551 | Human IFNA1 Lentivirus plasmid |
| ORF Viral Vector | pGMAD000576 | Human IFNA1 Adenovirus plasmid |
| ORF Viral Vector | pGMAP000481 | Human IFNA1 Adenovirus plasmid |
| ORF Viral Vector | vGMLP000155 | Human IFNA13 Lentivirus particle |
| ORF Viral Vector | vGMLP000551 | Human IFNA1 Lentivirus particle |
| ORF Viral Vector | vGMAD000576 | Human IFNA1 Adenovirus particle |
| ORF Viral Vector | vGMAP000481 | Human IFNA1 Adenovirus particle |
Target information
| Target ID | GM-SE0977 |
| Target Name | IFNA13 |
| Gene ID | 3447 |
| Gene Symbol and Synonyms | IFNA13 |
| Uniprot Accession | P01562 |
| Uniprot Entry Name | IFNA1_HUMAN |
| Protein Sub-location | Secreted Protein/Potential Cytokines |
| Category | Cytokine Target |
| Disease | Not Available |
| Gene Ensembl | ENSG00000233816 |
| Target Classification | Not Available |
Predicted to enable cytokine activity and type I interferon receptor binding activity. Predicted to be involved in several processes, including B cell activation; lymphocyte activation involved in immune response; and positive regulation of peptidyl-serine phosphorylation of STAT protein. Predicted to be located in extracellular region. Predicted to be active in extracellular space.
About GMVC

GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.


