Human EMD/EDMD/LEMD5 ORF/cDNA clone-Lentivirus particle (NM_000117)

Cat. No.: vGMLP000693

Pre-made Human EMD/EDMD/LEMD5 Lentiviral expression plasmid for EMD lentivirus packaging, EMD lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.

The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.

Target products collection

Go to EMD/EDMD products collection>>
(antibodies, antigen, VLP, mRNA, ORF viral vector, etc)

pdf MSDS
pdf Datasheet

Product information

Catalog No. Product Name lentivirus Grade lentivirus quantity
vGMLP000693 Human EMD Lentivirus particle Pilot Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
Research Grade 1.0E+8TU
5.0E+8TU
1.0E+9TU
GMP-like Grade inquiry
GMP Grade inquiry


Product Description

Catalog ID vGMLP000693
Gene Name EMD
Accession Number NM_000117
Gene ID 2010
Species Human
Product Type Lentivirus particle (overexpression)
Insert Length 765 bp
Gene Alias EDMD,LEMD5,STA
Fluorescent Reporter ZsGreen
Mammalian Cell Selection Puromyocin
Fusion Tag 3xflag (C-Terminal)
Promoter CMV
Resistance Amplicin
ORF Nucleotide Sequence ATGGACAACTACGCAGATCTTTCGGATACCGAGCTGACCACCTTGCTGCGCCGGTACAACATCCCGCACGGGCCTGTAGTAGGATCAACTCGTAGGCTTTACGAGAAGAAGATCTTCGAGTACGAGACCCAGAGGCGGCGGCTCTCGCCCCCCAGCTCGTCCGCCGCCTCCTCTTATAGCTTCTCTGACTTGAATTCGACTAGAGGGGATGCAGATATGTATGATCTTCCCAAGAAAGAGGACGCTTTACTCTACCAGAGCAAGGGCTACAATGACGACTACTATGAAGAGAGCTACTTCACCACCAGGACTTATGGGGAGCCCGAGTCTGCCGGCCCGTCCAGGGCTGTCCGCCAGTCAGTGACTTCATTCCCAGATGCTGACGCTTTCCATCACCAGGTGCATGATGACGATCTTTTGTCTTCTTCTGAAGAGGAGTGCAAGGATAGGGAACGCCCCATGTACGGCCGGGACAGTGCCTACCAGAGCATCACGCACTACCGCCCTGTTTCAGCCTCCAGGAGCTCCCTGGACCTGTCCTATTATCCTACTTCCTCCTCCACCTCTTTTATGTCCTCCTCATCATCTTCCTCTTCATGGCTCACCCGCCGTGCCATCCGGCCTGAAAACCGTGCTCCTGGGGCTGGGCTGGGCCAGGATCGCCAGGTCCCGCTCTGGGGCCAGCTGCTGCTTTTCCTGGTCTTTGTGATCGTCCTCTTCTTCATTTACCACTTCATGCAGGCTGAAGAAGGCAACCCCTTCTAG
ORF Protein Sequence MDNYADLSDTELTTLLRRYNIPHGPVVGSTRRLYEKKIFEYETQRRRLSPPSSSAASSYSFSDLNSTRGDADMYDLPKKEDALLYQSKGYNDDYYEESYFTTRTYGEPESAGPSRAVRQSVTSFPDADAFHHQVHDDDLLSSSEEECKDRERPMYGRDSAYQSITHYRPVSASRSSLDLSYYPTSSSTSFMSSSSSSSSWLTRRAIRPENRAPGAGLGQDRQVPLWGQLLLFLVFVIVLFFIYHFMQAEEGNPF

Reference




    Data / case study


    Click to get more Data / Case study about the product.



    Associated products


    Category Cat No. Products Name
    Target Antibody GM-Tg-g-IP0758-Ab Anti-EMD monoclonal antibody
    Target Antigen GM-Tg-g-IP0758-Ag EMD protein
    ORF Viral Vector pGMLP000693 Human EMD Lentivirus plasmid
    ORF Viral Vector vGMLP000693 Human EMD Lentivirus particle


    Target information

    Target ID GM-IP0758
    Target Name EMD
    Gene ID 2010, 13726, 699400, 25437, 101083409, 492249, 399681, 100059369
    Gene Symbol and Synonyms EDMD,EMD,LEMD5,STA
    Uniprot Accession P50402
    Uniprot Entry Name EMD_HUMAN
    Protein Sub-location Introcelluar Protein
    Category Not Available
    Disease Not Available
    Gene Ensembl ENSG00000102119
    Target Classification Not Available

    Emerin is a serine-rich nuclear membrane protein and a member of the nuclear lamina-associated protein family. It mediates membrane anchorage to the cytoskeleton. Dreifuss-Emery muscular dystrophy is an X-linked inherited degenerative myopathy resulting from mutation in the emerin gene. [provided by RefSeq, Jul 2008]



    About GMVC

    GDU

    GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.