Human CDK1/CDC2/ CDC28A ORF/cDNA clone-Lentivirus particle (NM_001786)
Pre-made Human CDK1/CDC2/ CDC28A Lentiviral expression plasmid for CDK1 lentivirus packaging, CDK1 lentivirus production, overexpression stable cell line development, cell transient transfection and gene delivery targeting T/B/NK cells, macrophages, cardiomyocytes, hepatocytes, and neurons.
The GM Vector Core (GMVC) specializes in custom lentivirus development and offers a range of lentivirus manufacturing solutions, leveraging state-of-the-art processes. Learn more about our services.
Go
to CDK1/CDC2 products collection
>>
(antibodies,
antigen, VLP, mRNA, ORF viral vector, etc)
Product information
Catalog No. | Product Name | lentivirus Grade | lentivirus quantity |
---|---|---|---|
vGMLP000873 | Human CDK1 Lentivirus particle | Pilot Grade | 1.0E+8TU |
5.0E+8TU | |||
1.0E+9TU | |||
Research Grade | 1.0E+8TU | ||
5.0E+8TU | |||
1.0E+9TU | |||
GMP-like Grade | inquiry | ||
GMP Grade | inquiry |
Product Description
Catalog ID | vGMLP000873 |
Gene Name | CDK1 |
Accession Number | NM_001786 |
Gene ID | 983 |
Species | Human |
Product Type | Lentivirus particle (overexpression) |
Insert Length | 894 bp |
Gene Alias | CDC2, CDC28A, P34CDC2 |
Fluorescent Reporter | ZsGreen |
Mammalian Cell Selection | Puromyocin |
Fusion Tag | 3xflag (C-Terminal) |
Promoter | CMV |
Resistance | Amplicin |
Sequence | ATGGAAGATTATACCAAAATAGAGAAAATTGGAGAAGGTACCTATGGAGTTGTGTATAAGGGTAGACACAAAACTACAGGTCAAGTGGTAGCCATGAAAAAAATCAGACTAGAAAGTGAAGAGGAAGGGGTTCCTAGTACTGCAATTCGGGAAATTTCTCTATTAAAGGAACTTCGTCATCCAAATATAGTCAGTCTTCAGGATGTGCTTATGCAGGATTCCAGGTTATATCTCATCTTTGAGTTTCTTTCCATGGATCTGAAGAAATACTTGGATTCTATCCCTCCTGGTCAGTACATGGATTCTTCACTTGTTAAGAGTTATTTATACCAAATCCTACAGGGGATTGTGTTTTGTCACTCTAGAAGAGTTCTTCACAGAGACTTAAAACCTCAAAATCTCTTGATTGATGACAAAGGAACAATTAAACTGGCTGATTTTGGCCTTGCCAGAGCTTTTGGAATACCTATCAGAGTATATACACATGAGGTAGTAACACTCTGGTACAGATCTCCAGAAGTATTGCTGGGGTCAGCTCGTTACTCAACTCCAGTTGACATTTGGAGTATAGGCACCATATTTGCTGAACTAGCAACTAAGAAACCACTTTTCCATGGGGATTCAGAAATTGATCAACTCTTCAGGATTTTCAGAGCTTTGGGCACTCCCAATAATGAAGTGTGGCCAGAAGTGGAATCTTTACAGGACTATAAGAATACATTTCCCAAATGGAAACCAGGAAGCCTAGCATCCCATGTCAAAAACTTGGATGAAAATGGCTTGGATTTGCTCTCGAAAATGTTAATCTATGATCCAGCCAAACGAATTTCTGGCAAAATGGCACTGAATCATCCATATTTTAATGATTTGGACAATCAGATTAAGAAGATGTAG |
Reference
Data / case study
Click to get more Data / Case study about the product.
Associated products
Category | Cat No. | Products Name |
---|---|---|
Target Antibody | GM-Tg-g-T49898-Ab | Anti-CDK1 monoclonal antibody |
Target Antigen | GM-Tg-g-T49898-Ag | CDK1 protein |
ORF Viral Vector | pGMPC001076 | Human CDK1 Mammalian (Non-Viral Vector) plasmid |
ORF Viral Vector | pGMLP000873 | Human CDK1 Lentivirus plasmid |
ORF Viral Vector | vGMLP000873 | Human CDK1 Lentivirus particle |
Target information
Target ID | GM-T49898 |
Target Name | CDK1 |
Gene ID | 983, 12534, 699269, 54237, 101101592, 100856079, 281061, 100072299 |
Gene Symbol and Synonyms |
CDC2,CDC28A,Cdc2a,CDK1,p34 |
Uniprot Accession | P06493 |
Uniprot Entry Name | CDK1_HUMAN |
Protein Sub-location | Introcelluar Protein |
Category | Therapeutics Target |
Disease | Cancer |
Gene Ensembl | ENSG00000170312 |
Target Classification | Kinase, Tumor-associated antigen (TAA) |
The protein encoded by this gene is a member of the Ser/Thr protein kinase family. This protein is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with this protein and function as regulatory subunits. The kinase activity of this protein is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of this protein also play important regulatory roles in cell cycle control. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
About GMVC
GMVC (GM Vector Core) is GeneMedi’s unique platform for QbD Viral vectors Processes development and manufacturing. In GMVC, our core expertise lies in the tailored production of viral vectors, including adeno-associated virus (AAV), lentivirus, and adenovirus. Our state-of-the-art facilities are equipped for scalable manufacturing, ensuring high-quality viral vector production to meet both research and therapeutic needs. Our expert team specializes in process development, leveraging innovative technology and extensive industry knowledge to provide clients with tailored solutions that exceed expectations. GMVC will be the ideal partner for scientists and healthcare professionals seeking reliable and efficient viral vector production services.